0
What would be the complementary strand of DNA to this example GGG ATC CAT GAC TTA AAC?
Wiki User
∙ 7y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the complementary strand of DNA to catttggga?
Gta aac cct
What would the complementary mRNA strand be for this gene tac ttg cta act?
AUG AAC GAU UGA Please specificy 5' 3' end for more clarity
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
What is the sequence of complementary nucleotides?
Ggc tct aac
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What strand of DNA of would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
What is the complementary nucleotide sequence of ccgagattg?
Ggc tct aac
What is the complimentary strand of 5' ACCCGAAATTTG 3'?
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
What strand of DNA would be produced from the template strand AAC CT?
Ttg ga
What strand of DNA would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
A DNA strand with the sequence AAC GTA ACG what is the sequence of the mRNA molecule synthesized?
UUG CAU UGC
