0
What else can I help you with?
What is the term for the 3' to 5' strand of DNA?
The term for the 3' to 5' strand of DNA is the "antisense strand."
What would be the complementary strand of 3 acgtgctacggtacg-5?
If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'
In which direction does replication occur 3 to 5 or 5 to 3?
Replication occurs in the 5' to 3' direction. The new DNA strand is synthesized in the 5' to 3' direction, while the parental template strand acts as the template for this synthesis. This directionality allows for continuous synthesis on one strand (leading strand) and discontinuous synthesis on the other strand (lagging strand).
What is the directionality of the nucleotide strand in terms of the 5' and 3' ends?
The nucleotide strand has directionality, with one end labeled as the 5' end and the other end as the 3' end. The direction of the strand goes from the 5' end to the 3' end.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
What is the term for the 3' to 5' strand of DNA?
The term for the 3' to 5' strand of DNA is the "antisense strand."
What is the complementary strandof bases for a strand with the bases TACGTT?
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
What would be the complementary strand of 3 acgtgctacggtacg-5?
If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'
In which direction does replication occur 3 to 5 or 5 to 3?
Replication occurs in the 5' to 3' direction. The new DNA strand is synthesized in the 5' to 3' direction, while the parental template strand acts as the template for this synthesis. This directionality allows for continuous synthesis on one strand (leading strand) and discontinuous synthesis on the other strand (lagging strand).
What is the complimentary strand of 5'- atgctatcattgaccttgagttattaa-3'?
a=g t=c So unless my eyes skipped a letter it should be something like: 3'- gcatcgctgccagttccagaccgccgg-5' Unless you're talking about transcribing to RNA. Then all the 'T's become 'U's.
What would the other strand of DNA be - g g t c g a a t?
5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand
What is the directionality of the nucleotide strand in terms of the 5' and 3' ends?
The nucleotide strand has directionality, with one end labeled as the 5' end and the other end as the 3' end. The direction of the strand goes from the 5' end to the 3' end.
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
What is the directionality of DNA synthesis when the template strand is read from 3' to 5'?
When the template strand of DNA is read from 3' to 5', DNA synthesis occurs in the 5' to 3' direction.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
