0
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).
Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What would be the complementary strand of 3 acgtgctacggtacg-5?
If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
An okazaki fragment has which of the following arrangements?
5' DNA to 3' Bipin
What is attgcat complementary strand sequence?
In DNA: 5' attgcat 3' 3' taacgta 5'
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the complementary strandof bases for a strand with the bases TACGTT?
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
What would be the complementary strand of 3 acgtgctacggtacg-5?
If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'
What is the complimentary strand of 5'- atgctatcattgaccttgagttattaa-3'?
a=g t=c So unless my eyes skipped a letter it should be something like: 3'- gcatcgctgccagttccagaccgccgg-5' Unless you're talking about transcribing to RNA. Then all the 'T's become 'U's.
Does DNA have a specific direction?
In a way Yes!, but also, in the same way no. Each strand of DNA is polymerized in the 5' to 3' direction. Meaning that to copy the strand of DNA, the enzyme used to do this (DNA polymerase) can only flow in this direction. However, the complimentary base paired strand also goes in the 5' to 3' direction, but it is opposite of what the other strand is. So basically you have one strand going 5' to 3' and one strand in the same direction going 3' to 5'Here is an example....Letters indicate basesA- adenineG- guanineC- cytosineT- thymine5'-AATTCGGTCCGTTCCGGCTAATCG-3'3'-TTAAGCCAGGCAAGGCCGATTAGC-5'The 5' or 3' direction basically indicates that there is a hydroxy group attached to the end of each sugar phosphate backbone so that the next nucleotide can be added by a hydrolysis reaction. In this way, the nucleotides can only be added from 5' to 3' making DNA a perfect molecule for enzymatic replication!Hope this helps!
What would the other strand of DNA be - g g t c g a a t?
5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
What is the coding DNA and mrna strand for the template strand 3' a-g-g-t-t-c-a-t 5'?
The top strand, which is drawn 5' to 3' and which contains the promoter sequences in the conventionally written orientation (such as the TATA box) and which has the same sequence as the new RNA (except for U instead of T) is the plus strand or the sense strand or the non template strand or the coding strand. The bottom 3' to 5' strand is the minus, or template, or antisense strand. Your sequence therefore is the coding strand, but the RNA is transcribed off of the non-coding, template, or antisense strand.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
An okazaki fragment has which of the following arrangements?
5' DNA to 3' Bipin
