0
What else can I help you with?
Related Questions
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
What is the complimentary strand of 5' ACCCGAAATTTG 3'?
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
What is the complimentary strand of GTA-GCA?
acg-att
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?
B. Complimentary
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
Trending Questions
What is the optimal pressure for freon in a 2003 Pontiac vibe?
Who many digress in a right angle?
Can you navigate from lake Marion SC to the Atlantic ocean by motor boat?
What is another word for scenic?
Is there a lemon law for all used cars?
Who was Walter lee dad in raisin in the sun?
What is a genetiast?
what is 20056 -200x 5=?
What is Africa's most dominant climate?
How many ml are in 0.25 mg?
What are the 5 ways people use cellulose?
What are the different types of bicycle frame parts and how do they contribute to the overall performance and durability of a bicycle?
What is the diet of a wombat?
If you something you use it carelessly Change 1 letter of the word HASTE?
What decision did okonkwo make?
What are the 3 properties of mangets?
What are the main characteristics of samba?
What eats penguins?
What country has three parts on one island and one part on the other?
I registered my webkinz and it did not have a room. How do I get it a room?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.