0
What else can I help you with?
Related Questions
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
What is the complimentary strand of 5' ACCCGAAATTTG 3'?
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
What is the complimentary strand of GTA-GCA?
acg-att
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?
B. Complimentary
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
Trending Questions
When was Secondhand Serenade formed?
When did Lu Yongxiang - warlord - die?
How do you say thunder and lightning in hebrew?
How can I stop my dog from growling at visitors?
What is a Funny name that starts with s?
Is the 1997 Toyota Camry 2.2L motor zero tolerance if the timing belt breaks?
What type of information do climate maps provide?
Who is the proponent of theory?
How 16.75 in to mixed fraction?
How much is a The 1994 Ryan Express commemorative set worth?
What spacecraft visited the planet Jupiter?
How can one effectively utilize a codon wheel for reading genetic codes?
How many people watch drama?
What do white buoys with orange markings indicate?
What is difference between CD and harddisk?
Which number best completes sequence 346913?
Which shapes and letters have rotational symmetry?
How do you make a chao that looks like Wacky in Sonic Adventure 2 Battle?
How much does a gas fireplace weight?
How many trazodone does it take to commit suicide?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.