0
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
Wiki User
∙ 13y ago
Wiki User
∙ 11y agoThe mRNA codon that would be complementary to the DNA codon CGT is GCA.
Wiki User
∙ 10y agoCUGUUCAGGUGUUAG
Wiki User
∙ 11y agocua ggc
Batu Ozkaner
Wiki User
∙ 7y agoGCU aga
bapjzzs
Wiki User
∙ 13y agouac-gca
Wiki User
∙ 10y agoUACGCA
Wiki User
∙ 7y agoCua ggc
Add your answer:
Earn +20 pts
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
What is the complementary strandof bases for a strand with the bases TACGTT?
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
Haw does antisense technology work?
Antisense technology is based on stopping the production of a protein. In order for a protein to be formed, the mRNA has to be translated (read by the ribosomes). The happens in the cytoplasm. There are stretches of nucleic acid bases called cDNA that are complimentary to specific mRNA sequences. These cDNA molecules can bind to the mRNA molecules and inactivate them. When mRNA is inactivated, it cannot be translated into a protein and a protein will not be formed. Since every protein is made by a certain mRNA, by inactivating the mRNA using cDNA molecules, the production of the protein can be stopped. This process is called mRNA silencing or antisense technology
What type of RNA is formed during transcription?
In Translation, rRNA, tRNA, and mRNA are used. The mRNA strand of codons (3 nucleotide bases) enters the ribosome where the rRNA will "read it" (it is made up of rRNA). tRNAs are floating in the cell carrying the anticodon's specified amino acid. When the rRNA "sees" which codon is on the mRNA strand, the tRNA's anticodon (complementary nucleotide bases) binds to the A site in the ribosome to start creating the polypeptide chain.
Ifa DNA triplet is CTA then what is the complimentary DNA?
Because Cytosine attaches with Guanine and adenine attaches with thymine, if CTA (cytosine, thymine, adenine) had another strand of DNA it should read GAT however mutations can occur.
How does m-RNA read DNA-CCAGTT?
The messenger RNA (or mRNA) compliment to a DNA strand of CCAGTT would be GGUCAA.
What would happen if mRNA was read backwards?
You would get ANRm.
What is the non template strand?
The difference between the coding strand and the template strand is the coding strand is the strand which contains the coding genes, i.e. the one in which the RNA polymerase reads and transcribes into mRNA. It must have the promoter sequence in the correct orientation for transcription, as follows:5`-TATAATGCGCGCGCGCGCGCGCGC-3`3`-ATATTACGCGCGCGCGCGCGCGCG-5`In this sequence, the top strand is the coding strand, because it contains the promoter (TATAAT) in the correct orientation.However, when transcribed, the mRNA will be as follows:5`-GCGCGCGCGCGCGCGCGCGC-3`This is because the polymerase transcribes from the template strand, on the opposide side to the coding strand, to make it in the same orientation as the coding strand.I hope I have explained it enough for people to understand, however if I haven't please read this article I found which explains it thoroughly:http://www.bio.net/bionet/mm/bioforum/1994-May/008821.html
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
What is the complementary strandof bases for a strand with the bases TACGTT?
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
What is the direction of synthesis of the new strand?
The template strand (DNA) is read by RNA polymerase in the 3'-5' direction. First, RNA polymerase binds to an A-T rich promoter on the DNA which is upstream from the site of translation. Because A-T bonds are weaker than C-G bonds, the double helix opens up at this point and RNA polymerase begins translation. While translaing the DNA template strand, it creates a complementory mRNA strand and thus the Mrna will read 5'-3' with new bases being added at the 3' end.
What is DNA sense?
The plus strand is the same as the sense strand and can also be called the coding or non-template strand. This is the strand that has the same sequence as the mRNA (except it has Ts instead of Us). The other strand, called the template, minus, or antisense strand, is complementary to the mRNA. Gotta love the use of 4 names to describe the same thing. Ah science, why do you torment us?
What is the mRNA for DNA molecule t-a-c- c- g -g?
If a DNA strand read CCTAGCT, its mRNA would read GGAUCGA.
Haw does antisense technology work?
Antisense technology is based on stopping the production of a protein. In order for a protein to be formed, the mRNA has to be translated (read by the ribosomes). The happens in the cytoplasm. There are stretches of nucleic acid bases called cDNA that are complimentary to specific mRNA sequences. These cDNA molecules can bind to the mRNA molecules and inactivate them. When mRNA is inactivated, it cannot be translated into a protein and a protein will not be formed. Since every protein is made by a certain mRNA, by inactivating the mRNA using cDNA molecules, the production of the protein can be stopped. This process is called mRNA silencing or antisense technology
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
What identifies the specific amino acid for tRNA?
The messenger RNA strand. When the tRNA inserts itself between the two portions of the ribosome attached to the mRNA strand, the specific tRNA depends on the 3 nitrogen bases on the mRNA (the codon) that are about to be read. The tRNA that arrives has a corresponding "anticodon" to go with the codon on the mRNA. For example, if the nitrogen bases on the mRNA strand are adenine, guanine, and cytocine the tRNA will have an anticodon of uracil, cytocine and guanine. The tRNA that has the corresponding anticodon to the codon on the mRNA will bring with it a specific amino acid but it is the codon on the mRNA that ultimately decided which amino acid is next in line.
What would happen if a cell were unable to make mrna?
If a mutation affects the mRNA, then the sequence of amino acids that it codes for may be incorrect, causing the protein produced by the amino acids to not function properly, or it may not function at all.
