0
A trand of DNA has the following order of bases CGTAtcga corresponding order of bases in the matching or Rna will be?
Wiki User
∙ 9y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
How many bases are in an anti-codon?
3 bases make up an anti-codon, 3 bases also make up a codon
What are all the bonds in DNA?
The hydrogen bonds that join together the nitrogen bases.
Which of the following ionizes forms ions in water?
Solubles ionic salts, acids, bases forms ions in water.
What is an explanation of how DNA is replicated?
during DNA replication, the DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing. Each strand of double helix of DNA serves as a template, or model, for the new strand. <3 , (:
How does the order of the bases on DNA contribute to the production of proteins?
RNA builds proteins by reading each base pair and adding the corresponding amino acid to the protein it's building. Essentially, the base pairs are a blueprint for the protein.
What is a strand of DNA that has CGTATCGA. The corresponding order of bases in the matching RNA?
UAGGCAG is the base sequence
How do the nitrogen bases pair up during replication?
By forming matching hydrogen bonds.
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What is the name of the enzyme that places the corresponding nitrogen bases on the new strand of DNA?
t know for sure idkgdkjnkgdfsgd
Is calcium hydroxide a stronger base than potassium hydroxide?
No, it is not.The bases of alkali metals are always more basic than the bases of the corresponding alkaline earth metals.
What is the shape of the bases for the following polyhedron?
It would help if the "following" did actually follow!
What does computer forensics use computer systems and technology for?
Mainly matching date from a particular crime with data in large data bases.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
How many bases are in an anti-codon?
3 bases make up an anti-codon, 3 bases also make up a codon
Which of the following nitrogen bases is unique to RNA?
they are the nitrogenous bases in RNA
What isAnother form of RNA called matches amino acids with the bases on the messenger RNA?
Transfer RNA or tRNA carries out the matching to assemble proteins.
