0
What is a strand of DNA that has CGTATCGA. The corresponding order of bases in the matching RNA?
Wiki User
∙ 7y ago
UAGGCAG is the base sequence
Wiki User
∙ 13y ago
Wiki User
∙ 10y agothe awnser is gcauagcu because rna does not contain thymine but it contains uracil instead
Wiki User
∙ 13y agou a g g c a g
Wiki User
∙ 7y agothe anwser would be chromesomes
Leilani Graham
AUUGCAGC
Add your answer:
Earn +20 pts
Suppose 1 strand of a DNA molecule contained the following bases a c g t c t g what would be the bases on the other strand?
tgcagac. A pairs with T and C Pairs with G.
What is the order of bases on the complementary side of the strand B from left to right?
AAACCCGTT I have an assignment for this SO I am 90% sure, but I know it's right.
The direction of synthesis of an RNA transcript is?
transcription:"the first step in protein synthesis, a sequence of nucleotide bases becomes exposed in an unwound region of a DNA strand. That sequence acts as a template upon which a single strand of RNA - a transcript - is synthesized from free nucleotides."The synthesis of an RNA molecule from the DNA template strand is called transcription.
How do traits get expressed?
Traits, which we define as visible aspects of an organism (known as the organism's phenotype) , are coded for by an organisms DNA and are expressed through the proteins that that DNA codes for. Here's the indepth version:Every living organism on this earth has DNA (or in some bacteria, RNA). These strands of DNA are made of nucleic bases (adenine, thymine, cytosine, and guanine), phosphates, and sugars. These components form DNA into the double helix shape we associate with DNA (the twisted ladder shape.) The nucleic bases are held together in the middle of the two strands by weak hydrogen bonds. This is what we know contemporarily as a strand of DNA.Strands upon strands of DNA are then packaged together (with protein formations generally called histones) to form what we know as the chromosome. DNA must be packaged this way so that the extremely long strands of DNA can be easily moved during sexual (or asexual) reproduction. But that's another topic.The expression of "traits" can be traced back specifically to the order of nucleic bases in the DNA, and the proteins those bases code for. Here's how it works.Let Organism A have a certain part of their DNA that readsATCAGCATAGCAUAGThese nucleic bases would then be paired with their complement bases on the other strand of DNA. But let us then say that the cells in Organism A want to express this trait. A process known as transcription and translation must occur.First, the DNA is "unzipped" by an enzyme. Then, another enzyme moves along the DNA and lays down a "primer strand" (this enzyme, fittingly, is called primase) of RNA. RNA is just like DNA, except that in RNA, Thymine is not existant and a particle known as ribose is present. There are different types of RNA, but in this instance, mRNA (messenger RNA) is used. Another enzyme will move along the DNA-mRNA strands, inserting completmentary bases on the RNA. But since thymine is not expressed in RNA, Adenine must match with another base (only present in RNA) called uracil. The above code would be expressed like this in mRNA:UAGUCGUAUCGUAUC(NOTE: Adenine always binds with Thymine or Uracil, Cytosine always binds with Guanine)This particular strand of mRNA is almost ready to leave the nucleus to be translated. First, a 5' cap and poly-A tail must be added to either end of the strand to protect it during transport.This mRNA is then taken to ribosomes in the cell, which are located outside the nucleus. This step is called translation.When the mRNA arrives at the ribosome, it begins to slide "through" the ribosome. Now, it is important to know that DNA and mRNA is read in groups of three. Every three bases, known as a codon, has a matching anticodon. These mRNA codons will feed through the ribosome, and according to the particular order of the bases, a molecule called tRNA (transport RNA) will arrive at the ribosome with the matching anticodons. Attatched to these tRNA structures are the matching anticodons and an amino acid.The above strand would then match with these anticodons. Note how the anticodons resemble the original DNA.AUCAGCAUAGCAUAGThe only difference is the fact that thymine is replaced by Uracil. The amino acids that are brought to the ribosome by tRNA then bind to each other through peptide bonds, eventually forming a polypeptide chain (the beginnings of a protein).Thus, we can see how DNA codes for RNA which then codes for specific amino acids. Scientists have developed a table that can determine which aminos are coded for according to the order of the bases.So, the need to know is this: DNA codes for mRNA in a process called transcription. Then, that mRNA is translated at ribosomes. The anticodons that bind to the mRNA determine which proteins are made. Ultimately, those proteins express traits based on the function of the protein.DNA codes for mRNA--> mRNA codes for tRNA anticodons---> the specific order of the assembled amino acids determines their function, thus expressing a trait.
A strand of mRNA has the bases guanine-adenine-uracil Which amino acid corresponds to these bases?
Asp
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
A protein contains 131 amino acids How many bases will there be on the mRNA strand corresponding to these amino acids and how do you know?
131*3=393 bases might be there on mRNA strand 3 codons of mRNA strand deduce an aminoacid of a protein, so here, mRNA strand bases are being asked.
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
What is the name of the enzyme that places the corresponding nitrogen bases on the new strand of DNA?
t know for sure idkgdkjnkgdfsgd
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
TTCGGT
Is the the term transcription appropriate for describing the production of RNA?
Yes. Transcription is the process by which a strand of DNA is matched with the corresponding bases to form a strand of RNA, with the exception of Thymine being replaced by Uracil in RNA.
If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?
the complimentary styrand would be: T-C-C-G-A-T
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
What is the particular side-by-side arrangement of bases along the DNA strand?
To what particular DNA strand are you referring?
What best describes why our understanding of DNA and inherited traits has changed over time?
As with any knowledge, it takes time to discover all the parts. The structure of DNA took time to learn. Then the fact that there were recurrence of 4 bases and these bases had matching bases on the second strand of DNA. We did not have the tools at first. As they came along, we learned more and more.
How many bases does a double helix have after the complementary strand is added?
double the amount of bases (or x2)
