0
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide.
Replace:
A for T
T for A
C for G
G for C
Wiki User
∙ 12y ago
Anonymous
Wiki User
∙ 15y agoThe matching is done as follows:
DNA - RNA:
A - U
T - A
G - C
C - G
Moo
Wiki User
∙ 15y agoIf the nucleotide sequence is cggattacaaactcggctaggcttgtagggctattgttgcg How would i determine the sequence of bases in the complentary strand to the DNA template strand?
Ursella Elani Du Pre...
gtactcaaggtctctag
Add your answer:
Earn +20 pts
What is the complementary strandof bases for a strand with the bases TACGTT?
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
Explain the function of replication?
DNA replication requires the opening of the 'zipped up' DNA strand. This is so a 'new' strand of DNA can be inserted and have a template strand to 'read' off. DNA polymerase analyses the bases on the template strand and adds each complementary base to synthesise the 'new' strand. In order for DNA polymerase to be able to do this the DNA has to be opened up by helicase to reveal the bases of the template strand. The unzipping of the DNA by helicase forms the replication fork. Thus the function of the replication fork is to reveal template strands for DNA replication to actually occur.
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
What is the complementary DNA sequence of ATCGA?
TCA is the complementary strand for AGT. Adenine forms double bond with thymine & guanine forms triple bond with cytosine & vice-versa
What is the complementary strandof bases for a strand with the bases TACGTT?
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
What is the new strand complementary to the old strand?
DNA strands are said to be complementary because they both match up with eachother; A with T and C with G. So if you have the strand ATGGCTA the complementary strand (the other half of the double helix) would read TACCGAT. So if you know one side of the strand then you can describe the whole.
Which sequence of RNA bases with pair up with a strand of DNA bases that reads TACTGCA?
it would read: atgacgt
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
Explain the function of replication?
DNA replication requires the opening of the 'zipped up' DNA strand. This is so a 'new' strand of DNA can be inserted and have a template strand to 'read' off. DNA polymerase analyses the bases on the template strand and adds each complementary base to synthesise the 'new' strand. In order for DNA polymerase to be able to do this the DNA has to be opened up by helicase to reveal the bases of the template strand. The unzipping of the DNA by helicase forms the replication fork. Thus the function of the replication fork is to reveal template strands for DNA replication to actually occur.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
What is DNA sense?
The plus strand is the same as the sense strand and can also be called the coding or non-template strand. This is the strand that has the same sequence as the mRNA (except it has Ts instead of Us). The other strand, called the template, minus, or antisense strand, is complementary to the mRNA. Gotta love the use of 4 names to describe the same thing. Ah science, why do you torment us?
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
What rna strand is complementary to the DNA strand gtagtca?
As long as the DNA strand sequence "CTAGGTTAC" is in the 5' to 3' position, the correct RNA sequence would be "CUAGGUUAC". RNA is identical to the coding strand, which is always read 5' to 3'. The only difference is U replaces T.
