0
TCA is the complementary strand for AGT. Adenine forms double bond with thymine & guanine forms triple bond with cytosine & vice-versa
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the complementary sequence for this DNA c-t-a-a-g-t-c?
To find the complementary sequence for a given DNA sequence, you need to match each nucleotide with its complementary base according to the base-pairing rules. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Given the DNA sequence: C - T - A - A - G - T - C The complementary sequence would be: G - A - T - T - C - A - G
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary base sequence of DNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
