0
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
Wiki User
∙ 14y ago
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
Ifa DNA triplet is CTA then what is the complimentary DNA?
Because Cytosine attaches with Guanine and adenine attaches with thymine, if CTA (cytosine, thymine, adenine) had another strand of DNA it should read GAT however mutations can occur.
What are four examples of codons and what are the instructions they encode?
Codon is a group of three bases on a DNA molecule, each determining the identity of one amino acid in proteins made by a cell. An example of a codon is the mRNA sequence of AUG.
What effect would changing the reading frame have in DNA?
We call these frameshift mutations. Since the genetic code is read in threes (codons) any sort of shift will cause the code to be incorrect.Here is an example of one sentence with words of only three letters:The big red pig ate the red rag. Each word will make one amino acid and the words make a sentence that makes sense. But a frameshift might make the sentence totally readable: The big res dpi gat eth ere dra g.
What is most important for generating the most genetic variability in a species?
The most important factors for generating the most genetic variability in a species are mutation and sexual reproduction. Mutation introduces new genetic variations by creating changes in the DNA sequence, while sexual reproduction shuffles and combines genetic material from two individuals, increasing the diversity within a population. These processes together facilitate the generation of genetic variability, which is essential for adaptation and evolution of a species.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complimentary strand of DNA would have the sequence: tacggctagttgg
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
Aggctaacctg is the first strand what is the 2nd strand of DNA?
Tcc gat tgg ac
What is the correct DNA complement of the DNA strand 5 g a t c g g t a c a g t g 3?
In DNA, A binds to T and C binds to G Therefore the complementary DNA sequence to 5'-GAT-CGG-TAC-AGT-G-3' is: 3'-CTA-GCC-ATG-TCA-C-5'
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
What is the complementary strand for the sequence c t t a g g c t t a c c a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
How many amino acids does the strand of DNA code for?
The DNA strand is split into threes called amino acids. The DNA strand is agg-gat-tac-agg so four amino acids.
If the DNA molecule is a-t-t-c-g-a-c-c-t-a-c-g What is the complementary strand of DNA produced?
If 5'- ATCAGACTCA -3' is the DNA template, 3'- UAGUCUGAGU -5' is the mRNA complement.Be careful: strands are always read 5' to 3'.
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
What is complementary to gatcgt during dna replication?
Ggt ctacca gat-----------All capitals as this moronic site can not interpret lettering for abbreviation purposes correctly.
