answersLogoWhite

0

DNA strands are said to be complementary because they both match up with eachother; A with T and C with G. So if you have the strand ATGGCTA the complementary strand (the other half of the double helix) would read TACCGAT. So if you know one side of the strand then you can describe the whole.

User Avatar

Wiki User

17y ago

What else can I help you with?

Continue Learning about Biology

What is the new strand called in Dna replication?

semiconservative replication - original DNA double strand will unwind into 2 strands, so one original strand will serve as a template for synthesizing a new complementary strand , thus forming a new DNA (one with old strand and one with a new strand)


When DNA replicates the new strand is what to the original strand?

The new strand is complementary to the original strand. This means that the bases on the new strand pair with the bases on the original strand according to the rules of base pairing (A with T and G with C).


An old DNA strand is used as a for the assembly of a new DNA strand?

In DNA replication, an existing DNA strand (template strand) is used to guide the assembly of a new complementary DNA strand. Enzymes like DNA polymerase add complementary nucleotides to each template strand, resulting in two identical DNA molecules. This process ensures accurate transmission of genetic information during cell division.


IMPORTANT After DNA replication does half of the old strand leave with half of the new strand?

The process of DNA replication is described as being semi-conservative. The complementary DNA strands are pulled apart, new matching nucleotides are connected to each separate strand, and the result is two new strands that each contain exactly one-half of the original DNA strand.


What is the name of the enzyme responsible for incorporating new complementary DNA nucleotides into the growing strand?

The enzyme responsible for incorporating new complementary DNA nucleotides into the growing strand is called DNA polymerase.

Related Questions

What is the new strand called in Dna replication?

semiconservative replication - original DNA double strand will unwind into 2 strands, so one original strand will serve as a template for synthesizing a new complementary strand , thus forming a new DNA (one with old strand and one with a new strand)


What is the complementary DNA?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?


When DNA replicates the new strand is what to the original strand?

The new strand is complementary to the original strand. This means that the bases on the new strand pair with the bases on the original strand according to the rules of base pairing (A with T and G with C).


What is the complementary DNA strands?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?


An old DNA strand is used as a for the assembly of a new DNA strand?

In DNA replication, an existing DNA strand (template strand) is used to guide the assembly of a new complementary DNA strand. Enzymes like DNA polymerase add complementary nucleotides to each template strand, resulting in two identical DNA molecules. This process ensures accurate transmission of genetic information during cell division.


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.


What do the complementary strand for ccgatacgcggtatcccagggctaattuaa?

The complementary strand for the DNA sequence ccgatacgcggtatcccagggctaattuaa is ggctatgcgccatatgggtaatgtaagg. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each nucleotide in the original strand is matched with its complementary base to form the new strand.


What allows the old strand and the new strand to come back together?

The complementary base pairing between adenine and thymine, and between cytosine and guanine, allows the old strand and the new strand of DNA to come back together during DNA replication. This pairing ensures the accurate synthesis of the new DNA strand.


IMPORTANT After DNA replication does half of the old strand leave with half of the new strand?

The process of DNA replication is described as being semi-conservative. The complementary DNA strands are pulled apart, new matching nucleotides are connected to each separate strand, and the result is two new strands that each contain exactly one-half of the original DNA strand.


Given the following strand of dna what is the complementary strand actggctac?

The complementary DNA strand to ACTGGCTAC is TGACCGATG.


What is the name of the enzyme responsible for incorporating new complementary DNA nucleotides into the growing strand?

The enzyme responsible for incorporating new complementary DNA nucleotides into the growing strand is called DNA polymerase.


During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?

GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.