aug-gga-aau-cau-cgg-uga
In RNA there's no 't' so you use a 'u' instead.
For DNA:
'a' goes with 't'
'c' goes with 'g'
***Remember AT&T for the pairing, and then the other two letters just match up.***
For DNA into RNA:
'a' goes with 'u'
'c' goes with 'g'
aug-gga-aau-cgg-uca
Thymine is replaced by Uramine in the RNA sequence.
The different sets of 3 will tell you what kind of amino acid this string of RNA will produce.
3'-T A C C C T T T A G T A G C C A C T-5'
5- augggaaaucaucgguga-3
A codon
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
gaugcgauccguaaucugaccau
TAGC
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
ATAGCC is complementary to the base sequence TATCGG.
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
gaugcgauccguaaucugaccau
When RNA's base sequence is used to determine the base sequence of a new strand of DNA, that is called reverse transcription.This is because the process is the reverse of transcription, which involves copying the base sequence of DNA to form RNA, including messenger RNA (mRNA).
Transcription.During transcription the base sequence (genetic code) of part (a gene) of one strand of DNA is copied onto a strand of RNA as the RNA is synthesized.
Transcription produces MRNA.
TAGC
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
ATAGCC is complementary to the base sequence TATCGG.
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
During transcription, the resulting bases on the mRNA if the DNA has the base adenine is Proteins.
Tyrosine. If ATA is the DNA codon, the mRNA transcription would be UAU (since A pairs with U in RNA rather than T). UAU codes for tyrosine.