answersLogoWhite

0


Best Answer

aug-gga-aau-cau-cgg-uga

In RNA there's no 't' so you use a 'u' instead.

For DNA:

'a' goes with 't'

'c' goes with 'g'

***Remember AT&T for the pairing, and then the other two letters just match up.***

For DNA into RNA:

'a' goes with 'u'

'c' goes with 'g'

User Avatar

Wiki User

13y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

14y ago

aug-gga-aau-cgg-uca

Thymine is replaced by Uramine in the RNA sequence.

The different sets of 3 will tell you what kind of amino acid this string of RNA will produce.

This answer is:
User Avatar

User Avatar

Wiki User

10y ago

3'-T A C C C T T T A G T A G C C A C T-5'

This answer is:
User Avatar

User Avatar

Wiki User

13y ago

5- augggaaaucaucgguga-3

This answer is:
User Avatar

User Avatar

Wiki User

15y ago

A codon

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: If the DNA base sequence is 3'-taccctttagtagccact-5'.What would be the base sequence of RNA after transcription?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

What would be the mrna base sequence formed during transcription using the DNA sequence below?

Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.


What base sequence would be produced through transcription ACGTAAGCT?

gaugcgauccguaaucugaccau


What is is called when RNA copies to DNA?

When RNA's base sequence is used to determine the base sequence of a new strand of DNA, that is called reverse transcription.This is because the process is the reverse of transcription, which involves copying the base sequence of DNA to form RNA, including messenger RNA (mRNA).


What is the process of going from DNA to RNA called?

Transcription.During transcription the base sequence (genetic code) of part (a gene) of one strand of DNA is copied onto a strand of RNA as the RNA is synthesized.


What is the process called when mRNA is made on the DNA in the nucleus?

Transcription produces MRNA.


If a strand of DNA were composed of the base sequence ATCG what would be the sequence of it opposing base pairs?

TAGC


If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?

The mRNA will have codons AUG-CCA-GUA-GGC-CAC


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?

RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU


During transcription if the dna has the base adenine the resulting bases on the mRNA is?

During transcription, the resulting bases on the mRNA if the DNA has the base adenine is Proteins.


What amino acid wuld be produced of transcrition takes place from a nucleotide with the three-base sequence ATA?

Tyrosine. If ATA is the DNA codon, the mRNA transcription would be UAU (since A pairs with U in RNA rather than T). UAU codes for tyrosine.