0
If a strand of DNA were composed of the base sequence ATCG what would be the sequence of it opposing base pairs?
Wiki User
∙ 15y ago
TAGC
Wiki User
∙ 15y ago
Add your answer:
Earn +20 pts
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the others strand?
in DNA, each base pairs up with only one other base
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What determines the nitrogen base sequence of a DNA in a new strand of DNA?
Since A pairs with T, and G pairs with C, then the sequence of bases in the strand of DNA being copied determines the sequence of bases in the newly copied strand. The bases are complementary (A gives T and G gives C when copied).
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the others strand?
in DNA, each base pairs up with only one other base
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complimentary strand of DNA would have the sequence: tacggctagttgg
What is the difference between positive strand and negative strand viruses?
A positive strand virus is immediately contagious. A negative strand virus has to create proteins to convert into a positive strand virus. it is not contagious until it becomes a positive strand.
What would the complementary strand of DNA be for the sequence cttaggcttacca?
GGATCGA is comlementary to the DNA strand CCTAGCT.
The sequence of bases in DNA determines the sequence of what?
When a new DNA is formed , two strands of old DNA open and act as a template for synthesis of two new strands of DNA .Sequence of bases in new strand of DNA is determined by old strand and it is based on complementarity i.e. A pairs with T and G Pairs with C .
What determines the nitrogen base sequence of a DNA in a new strand of DNA?
Since A pairs with T, and G pairs with C, then the sequence of bases in the strand of DNA being copied determines the sequence of bases in the newly copied strand. The bases are complementary (A gives T and G gives C when copied).
What is the relationship of the two DNA strands to each other?
The two strands in a DNA molecule (the polynucleotides) are complementary to each other. This means that the base sequence in one strand determines the base sequence in the other strand. This happens because of specific base pairing. An adenine in one strand always pairs with a thymine in the other strand, and a cytosine in one strand always pairs with a guanine in the other strand. So if you know the base sequence in one strand of the DNA yoiu can work out the sequence in the complementary strand. See: http://www.phschool.com/science/biology_place/biocoach/dnarep/basepair.htmlDNA strands run anti-parallel from one another, and have a double helix structure. The strands are held together by hydrogen bonds between base pairs that are weak individually, but collectively strong.
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
