0
If the base sequence on a separated DNA strand is CGTAGG what will the base sequence on its complementary strand be?
Wiki User
∙ 6y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the sequence of complementary strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary base sequence of DNA strand?
TGCA
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
What sequence in human DNA is the forward primer complementary to?
forward primers are complementary to anti sense strand of the dsDNA
A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?
tcaa --remember a attracts t while c attracts g
