0
In the cases of MRNA and DNA there are differences in the base pairs that make up the two compounds. In a situation in which Adenosine, Thymine, and Cytosine would need to be paired between DNA and RNA Guanine would be used on the RNA side.
Wiki User
∙ 10y ago
Add your answer:
Earn +20 pts
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary base sequence of DNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
What sequence in human DNA is the forward primer complementary to?
forward primers are complementary to anti sense strand of the dsDNA
