The template sequence would be 5' TTGATGGCT 3'.
You can find any DNA template sequence by finding the complementary base pair sequence for the mrna sequence. To do this, remember that A matches with U or T (U is used in the RNA strands wheras T is used in the DNA strands) and G matches with C (and vice versa). Next just flip the 5' and 3' ends because the complementary strands are always antiparallel to each other.
3' uacggucaguag 5'
Uracil is replaced for thymine in RNA. The mRNA strand would be opposite is the 3' to 5' strand.
The sequence would be:
UAU UGC GGA UAA
5' CAGTCTACCTATTGAGTACTGTCCATGGT 3'
cggtaaagggcaat
Aug gcc uac ggu cua guu uag
GGCAUGA
lysine
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
To my knowledge there is no such thing as a DNA translation enzyme. DNA is not translated; it is transcribed. During transcription, RNA polymerases create mRNA molecules by reading off from the sequence of the DNA template strand. Then the mRNA molecule is translated by ribosomes that convert that use each successive codon of the mRNA sequence to code for a particular amino acid. This last process - the use of sequence information in mRNA to direct the synthesis of a polypeptide chain - that is translation and it does not involve DNA.
Protein synthesis is a cellular process that is accomplished by ribosomes. Ribosomes are responsible for translating the genetic information encoded in mRNA into a specific sequence of amino acids, which form proteins. They do this by reading the mRNA and aligning the correct amino acids according to the codons on the mRNA strand.
The sequence of amino acids (forming a protein) that result from the mRNA strand CAG-AAG-UUC-CUC-UCG-C would be: Glutamine-Threonine-Phenylalanine-Leucine-Serine Each codon must be three bases long - therefore the end of this mRNA sequence 'C' cannot code for an amino acid. There would also need to be a stop codon at the end to complete translation.
The complimentary strand of MRNA would be AAUUCCGG.
Remember that in rna Uracil replaces Thymine so ACUGCGU.
TGCA
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
The corresponding mRNA strand would be AUCG.
an anticodon is a base sequence on tRNA which is completmently to the codon on the mRNA strand.
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
sequence of nitrogen based pairs in associated DNA
3 nucleotides
The addition or deletion of a nucleotide can lead to a Frameshift mutation. The Frameshift mutation causes a "shift" in the reading frame of the codons in the mRNA. This may lead to the change in the amino acid sequence at protein translation.