0
The template sequence would be 5' TTGATGGCT 3'.
You can find any DNA template sequence by finding the complementary base pair sequence for the mrna sequence. To do this, remember that A matches with U or T (U is used in the RNA strands wheras T is used in the DNA strands) and G matches with C (and vice versa). Next just flip the 5' and 3' ends because the complementary strands are always antiparallel to each other.
Wiki User
∙ 15y ago
Wiki User
∙ 14y ago3' uacggucaguag 5'
Uracil is replaced for thymine in RNA. The mRNA strand would be opposite is the 3' to 5' strand.
Wiki User
∙ 13y agoThe sequence would be:
UAU UGC GGA UAA
Wiki User
∙ 15y ago5' CAGTCTACCTATTGAGTACTGTCCATGGT 3'
Wiki User
∙ 15y agocggtaaagggcaat
Wiki User
∙ 11y agoAug gcc uac ggu cua guu uag
Wiki User
∙ 11y agoGGCAUGA
Anonymous
lysine
Add your answer:
Earn +20 pts
If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
What are the DNA Translation enzymes?
To my knowledge there is no such thing as a DNA translation enzyme. DNA is not translated; it is transcribed. During transcription, RNA polymerases create mRNA molecules by reading off from the sequence of the DNA template strand. Then the mRNA molecule is translated by ribosomes that convert that use each successive codon of the mRNA sequence to code for a particular amino acid. This last process - the use of sequence information in mRNA to direct the synthesis of a polypeptide chain - that is translation and it does not involve DNA.
A cellular process that is accomplished by a ribosomes?
Protein synthesis is a cellular process that is accomplished by ribosomes. Ribosomes are responsible for translating the genetic information encoded in mRNA into a specific sequence of amino acids, which form proteins. They do this by reading the mRNA and aligning the correct amino acids according to the codons on the mRNA strand.
What is the protein strand created from the mrna strand cagaaguuccucucgc?
The sequence of amino acids (forming a protein) that result from the mRNA strand CAG-AAG-UUC-CUC-UCG-C would be: Glutamine-Threonine-Phenylalanine-Leucine-Serine Each codon must be three bases long - therefore the end of this mRNA sequence 'C' cannot code for an amino acid. There would also need to be a stop codon at the end to complete translation.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
Remember that in rna Uracil replaces Thymine so ACUGCGU.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
What is a anyi-codon?
an anticodon is a base sequence on tRNA which is completmently to the codon on the mRNA strand.
What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
The code of mrna directly dependent on the?
sequence of nitrogen based pairs in associated DNA
How many bases on a strand of mRNA code for one amino acid?
3 nucleotides
What can occur as a result of a change in the sequence of nucleotides in a strand of DNA?
The addition or deletion of a nucleotide can lead to a Frameshift mutation. The Frameshift mutation causes a "shift" in the reading frame of the codons in the mRNA. This may lead to the change in the amino acid sequence at protein translation.
