0
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
Wiki User
∙ 13y ago
Wiki User
∙ 11y agoIt is ATCAGT.
Add your answer:
Earn +20 pts
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the complementary base sequence of DNA strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What would be the base sequence of the complementary mRNA strand?
TGCA
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?
tcaa --remember a attracts t while c attracts g
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?
3-gttcacctta-5
What sequence in human DNA is the forward primer complementary to?
forward primers are complementary to anti sense strand of the dsDNA
