answersLogoWhite

0


Best Answer

The mRNA sequence that is complementary to the sequence ATC on DNA is UAG. UAG is a codon that stops protein synthesis.

User Avatar

Wiki User

โˆ™ 2014-08-26 21:15:45
This answer is:
๐Ÿ™
0
๐Ÿคจ
0
๐Ÿ˜ฎ
0
User Avatar
Study guides
3.8
โ˜†โ˜…โ˜†โ˜…โ˜†โ˜…โ˜†โ˜…โ˜†โ˜…
65 Reviews

Add your answer:

Earn +20 pts
Q: The mRNA sequence that is complementary to the sequence atc on DNA is?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

MRNA sequence that is complementary by sequence ATC on DNA would be?

In the cases of MRNA and DNA there are differences in the base pairs that make up the two compounds. In a situation in which Adenosine, Thymine, and Cytosine would need to be paired between DNA and RNA Guanine would be used on the RNA side.


What are the major steps of mRNA transcription?

mRNA is produced based on the DNA code. If the original (correct) sequence is AGC, then the correct mRNA sequence should be UCG.However, the mutated DNA sequence (ATC) now codes for the mRNA sequence UAG. So, the incorrect DNA sequence is spread through to create an incorrect mRNA sequence.


Why can't the mRNA base sequence ATC be a codon?

RNA uses Uracil (U) in place of Thymine (T). Thymine is exclusive to DNA.


If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?

If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.


Which dna strand is complementary to cga atc agc?

Gct tag tcg


What is mrna for dna strand atc gca gga tgc?

Atc gca gga tgcuag cgu ccu acg


What would be the sequence on the complementary strand of DNA?

In DNA, A (adenine) binds to T (thymine), C (cysteine) binds to G (guanine). For a complementary RNA strand, A binds to U (uracil). For example, the complementary DNA strand for AAT-GCG-TAG would be TTA-CGC-ATC. The complementary RNA strand would be UUA-CGC-AUC.


What would be the complementary sequence for gac-tag-tat-tcc-g?

CTG-ATC-ATA-AGG-C


If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?

ATC(Adenine-Thymine-Cytosine)


How can you complete the complementary strand for the base sequence acg tag gct tca gct?

TGC ATC CGA AGT CGA


What is the opposite DNA strand of atctcg?

In DNA, A binds with T and C binds with G. Therefore the complementary strand for ATC-TCG would be TAG-AGC.


What would the complementary mRNA strand be for this gene tac atg gcg tag gta taa atc?

aug uac cgc auc cau auu uag


What would the complementary mRNA strand be for this gene atc cgt tat gta cca?

UAG GCA AUA CAU GGU btw, I got 100% on the ce.byu.edu speedback


When DNA replication occurs before meiosis the original DNA strand cag ccg tag is copied into complementary strand gtc aca ggc atc what type of mutation has occurred?

insertion


Are the DNA molecule parallel or antiparrallel?

The DNA molecule is anti-parallel. This is because the two strands are the opposite of one another, such that if one strand has the base sequence ATC, the opposite strand would have the base sequence TAG.


How do you translate this to to messenger RNA from DNA ccg atc gac cga?

The messenger RNA sequence would be: CCG UAG CUG GCU


Is one strand of DNA that is complementary to the other strand opposite or matching?

I don't know what you mean by complementary, so I'll use an example. If a section of one strand of DNA is ATC GGA TAC ACC, then the other will be (in the same direction) TAG CCT ATG TGG If you are looking for the messenger RNA code, change all the Ts to Us in the second code of my answer. Hope this helps!


What molecule makes a mirror copy of DNA?

There is not really such a thing as a mirror image of DNA in nature. DNA polymerase may be the "molecule" that you are thinking of, it is an enzyme that replicates DNA. When the polymerase makes a new strand of DNA, it uses an existing strand of DNA as a template. The new strand of DNA is not in fact a mirror image of the template strand, but it is the closest thing possible. The new strand is called a complementary strand, not a mirror image.Existing DNA (template for polymerase): ATC TGA CCG GAC TAG GGTNew strand (made by polymerase): TAG ACT GGC CTG ATC CCAAlternatively, by mirror image of DNA you may be thinking of RNA, a ribonucleotide that is made by RNA polymerase. The process is similar to that described above, but the new complementary strand is made out of ribonucleic acid rather than deoxyribonucleic acid.


What would the complementary strands for dna a-t-c-g-c-t-g-a-t-g-a-c-g-a-c-t?

A binds to T, C binds to G. Therefore the complementary strand of ATC-GCT-GAT-GAC-GACT would be TAG-CGA-CTA-CTG-CTGA.


How do tRNA and mRNA differ in their location within the cell and chemical composition?

Chemically tRNA and mRNA differ in the base adenine and thymine. In a tRNA strand, instead of having the complementary base pairs of A-T,the matching base pair to the Thymine would be replaced by uracil (u). Consider the following mRNA strand: 5' --- GCG CCC ATC AAA-- 3' 3' --- CGC GGG TAG TTT- 3' For the 3' to 5' direction, the tRNA strand would read: 3' --- CGC GGG UAG UUU-- 3' The thymine base pair is replaced by uracil. Locate of the mRNA and the tRNA strand differ because they are involved in different cell functions. mRNA is involved in DNA amplification and duplication and is found in the nucleus from where it is finally transfered to the cytoplasm after post translational modification. Where as, tRNA is involved in protein synthesis and IS found in the cytoplasm (originally formed in the nucleus) along with ribosome /newzhyphenz protein complexes.


What is the mrna strand ggctatatcctgcgctatacgcta?

First, separate the letters into codons so they are easier to read: ggc tat atc ctg cgc tat acg cta Then, convert them into mrna, replacing the g's with c's, the c's with g's, the t's with a's, and the a's with u's. Unlike DNA, RNA doesn't contain t, but it can still translate t's. ccg aua uag gac gcg aua ugc gau


What does atc stand for on an atc 70?

* ALL TERRAIN CYCLE


What is GENCO ATC's population?

GENCO ATC's population is 10,000.


When was GENCO ATC created?

GENCO ATC was created in 1898.


What is the formula for profit per unit?

P-ATC or MR-ATC