0
What Assume that a segment of DNA has the base sequence ACGT. Which base sequence would be found on the complementary strand of DNA?
Wiki User
∙ 7y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What nucleotide sequence would be found on the partner DNA strand of the strand shown ACTGT?
The complementary (partner) strand to the segment ACTGT would be TGACA. This is because in DNA, A binds to T and C binds to G.
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
What are the base sequence of the strand of mRNA that is complementary to this segment of DNA having the following base sequence 5'GATCACCGTAGA3' show the corresponding 3' and 5' ends?
5' ttagag3' The above is wrong. Actually, it's 5' ttagcg3' The a complements the t; so the t complements the a and the g complements the c; so the c complements the g.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the sequence of complementary strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What nucleotide sequence would be found on the partner DNA strand of the strand shown ACTGT?
The complementary (partner) strand to the segment ACTGT would be TGACA. This is because in DNA, A binds to T and C binds to G.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary base sequence of DNA strand?
TGCA
What would be the base sequence of the complementary mRNA strand?
TGCA
Complementary strand of DNA for gene segment gccaatgct?
The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
