0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
If the strand of DNA has the nucleotides TACCGGACCTGAAGT what would the mRNA strand be?
First of all, it is codons,not condons. MRNA would have uug auc cca. If I am not incorrect, you only use the term codons for MRNA, not in the actual DNA strand. The Anticodons would then be in the TRNA, which codes for the Amino Acids needed by the cells.
What rna sequence is transcribed using the DNA sequence agc-tac-act?
The sequence of the RNA would be UCG-AUG-UGA.
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What would be the strand of complementary DNA produce by the strand of DNA tcg aag?
Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
How many amino acids does the strand of DNA code for?
The DNA strand is split into threes called amino acids. The DNA strand is agg-gat-tac-agg so four amino acids.
If the strand of DNA has the nucleotides TACCGGACCTGAAGT what would the mRNA strand be?
First of all, it is codons,not condons. MRNA would have uug auc cca. If I am not incorrect, you only use the term codons for MRNA, not in the actual DNA strand. The Anticodons would then be in the TRNA, which codes for the Amino Acids needed by the cells.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What rna sequence is transcribed using the DNA sequence agc-tac-act?
The sequence of the RNA would be UCG-AUG-UGA.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
