0
What are the complementary mRNA and tRNA sequences for this sequence of DNA bases CGA?
Wiki User
∙ 7y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
How do dna bases pair up with mrna bases?
The mRNA bases are complementary to the DNA bases, and so form H-bonds when the DNA is single-stranded. DNA - mRNA A - U T - A C - G G - C
What are the bases on the mRNA strands are called?
A 3-base sequence of nitrogen bases on a molecule of mRNA is called a codon.
How did you know which bases to use when you transcribed the DNA sequence to mRNA codons?
In transcription, the mRNA strand is formed by complementary base pairing of the template DNA strand. However we should note that the nitrogenous bases in mRNA are Adenine, Guanine, Cytosine and Uracil, while those in DNA are Adenine, Guanine, Cytosine and Thymine.So the mRNA strand would be formed by matching the A in DNA with U in mRNA, T in DNA with A in mRNA, C in DNA with G in mRNA and G in DNA with C in mRNA.I hope that helps!
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
The set of three nitrogen bases on tRNA that is complementary to an mRNA codon is called?
These nucleotide sequences are called anticodons.
What determines the sequence of bases in mRNA?
the sequence of bases in DNA
What is the relationship between codons and anticodons?
A codon is found in the DNA sequence and in the mRNA sequence. The anticodon is the opposite sequence that would match with the sequence of the codon and allows pairing of the anticodon with the codon
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What would be the base sequence of the complementary mRNA strand?
TGCA
If the DNA secquence to be transcribed is actg then the resulting mRNA sequence will be?
if the DNA sequence is A C T G then its resulting mRNA sequence will be complementary so it will be T G A C
How do dna bases pair up with mrna bases?
The mRNA bases are complementary to the DNA bases, and so form H-bonds when the DNA is single-stranded. DNA - mRNA A - U T - A C - G G - C
