0
What else can I help you with?
The two main purposes for analyzing vntr dna from dna fingerprints are matching tissues and inheritance?
Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.
What does the "A" in DNA stand for?
The "A" in DNA stands for adenine.
What bases would match up to form a matching DNA strand from this pattern?
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
How does base pairing contribute to the accuracy of DNA replication?
Base pairing in DNA replication ensures that the correct nucleotides are added to the new DNA strand, matching with their complementary bases. This contributes to the accuracy of DNA replication by reducing the chances of errors or mutations in the newly synthesized DNA strand.
How does the process of DNA replication occur, considering the fact that DNA polymerase can only add nucleotides?
During DNA replication, the enzyme DNA polymerase adds nucleotides to the growing DNA strand by matching them with the complementary nucleotides on the template strand. This process ensures accurate copying of the genetic information.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
The two main purposes for analyzing vntr dna from dna fingerprints are matching tissues and inheritance?
Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.
What does the "A" in DNA stand for?
The "A" in DNA stands for adenine.
What is a base that forms with thymine?
DNA!! the matching strands of rna form dna..
What do the lettters DNA stand for?
DNA stands for Deoxyribonucleic acid
What do the abbreviations DNA stand for?
DNA is an abbreviation for Deoxyribonucleic Acid.
What bases would match up to form a matching DNA strand from this pattern?
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
What is a matching strand of DNA compared to AGTAAC?
A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.
Doesn't DNA stand for deoxyribonucleic acid Sorry for spelling?
DNA does stand for deoxyribonucleic acid and you spelled it exactly right.
Is it possible to get an accurate DNA test from your father's brother to see if your father is actually your father?
It would not be accurate, but there would be some traces of matching dna.
What does the in DNA stand for?
deoxyribonucleic acid
What do DNA or RNA stand for?
DNA - Deoxyribonucleic acid RNA - Ribonucleic acid
