0
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
Wiki User
∙ 9y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
DNA replication that unzip the DNA strand is?
What unzips DNA strand is a particular protein called Helicase. Helicase unwinds DNA's double helix at the replication fork.
Is DNA replication the same as DNA repair?
no replication makes a whole new strand of identical DNA while repair just replaces or cuts out mutations in the DNA strand
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What does replication mean in biology?
The process of duplicating or producing an exact copy, as in DNA replication.
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
What is the DNA strand that is synthesized continuously during DNA replication?
leading strand
What happens at the DNA replication fork?
The DNA replication fork is where the replication origin forms the Y shape. The replication fork moves down the DNA strand to the strand's end, resulting in every replication fork having a twin.
DNA replication that unzip the DNA strand is?
What unzips DNA strand is a particular protein called Helicase. Helicase unwinds DNA's double helix at the replication fork.
Is DNA replication the same as DNA repair?
no replication makes a whole new strand of identical DNA while repair just replaces or cuts out mutations in the DNA strand
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What acts as the origianl template in DNA replication?
A strand of DNA
What does replication mean in biology?
The process of duplicating or producing an exact copy, as in DNA replication.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What does semi conservation mean in terms of DNA replication?
DNA Replication is semi-conservative because each DNA molecule is composed of 1 old strand and 1 new strand
At the end of replication each new DNA molecule is composed of?
After DNA replication, each new molecule has one strand of the original DNA molecule and the other strand is composed of new nucleic acids. This is due to the semi-conservative replication of DNA.
Does the process of DNA replication result in a copy of the original strand of DNA?
The process of DNA replication is semi-conservative. Which means, in the new (daughter) DNA double helices that are formed, one strand belongs to the parent strand (also referred to as the template strand) and the other is a newly synthesized strand. Subsequently, every new DNA molecule that is formed as a result of the replication process has one original parent strand and one newly synthesized complimentary strand.
