0
What would be the complimentary sequence of bases produced by a DNA strand with the bases ctgcca?
Wiki User
∙ 10y ago
a-t-g-g-a-g-c-g-t-t-g-a
A pairs with T and G pairs with C. It doesn't matter how long the strand is....it's so ******in' simple.
A-T bonds are stronger than G-C bonds. A-t rich regions of DNA are hard and don't code for many functioning genes.
G-C rich regions are where the active genes are found.
A-t Regions stain dark blue-black w/ Geimsa, Leishman's or wright's stain etc... G-C regions do not. That's how banding patterns are achieved and chromosomes can be more accurately identified.
Wiki User
∙ 12y ago
Wiki User
∙ 14y agoc-c-g-t-a-t. A (adenine) and T (thymine) are always paired, as are C (cytosine) and G (guanine)
Wiki User
∙ 14y agoa-a-t-g-t-t-a-t-ac-a-a-g-g-c-a-t- t-t-a-c-a-a-t-a-tg-t-t-c-c-g-t-a
Wiki User
∙ 10y agoThe sequence would be GACGGT
Wiki User
∙ 14y agoOn DNA: AGCTGAAGT On RNA: AGCUGAAGU
Wiki User
∙ 11y agotggctacac
Add your answer:
Earn +20 pts
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
How do you find a complimentry strand of DNA?
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complimentary strand of DNA would have the sequence: tacggctagttgg
What determines the sequence of the nitrogenous bases in a new DNA strand?
It's complimentary pair. C--G and T--A
How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?
one amino acid in the sequence would change
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
