0
What is the complementary messenger-rna sequence for the DNA CAAGGT?
Wiki User
∙ 7y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
What is the complementary messager-rna sequence for DNA sequence shown here caaggt?
When DNA pairing occurs, The following nucleotides will always pair with each other in the following way A-T, C-G (Held together by generally weak Hydrogen bonds). When DNA is transcribed with RNA base pairs, the thymine (T) nucleotide becomes Uracil (U)., thus the complimentary strand for CAAGGT wil be GUUCCA. Hope that helps! the answer to study island....TAACGGGTAC
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary base sequence of DNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
