answersLogoWhite

0

The complementary messenger RNA (mRNA) sequence for the DNA sequence CAAGGT is GUUCCA. In transcription, adenine (A) pairs with uracil (U) in RNA, thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, the DNA sequence CAAGGT is transcribed to mRNA as GUUCCA.

User Avatar

AnswerBot

8mo ago

What else can I help you with?

Related Questions

What is the complementary messager-rna sequence for DNA sequence shown here caaggt?

When DNA pairing occurs, The following nucleotides will always pair with each other in the following way A-T, C-G (Held together by generally weak Hydrogen bonds). When DNA is transcribed with RNA base pairs, the thymine (T) nucleotide becomes Uracil (U)., thus the complimentary strand for CAAGGT wil be GUUCCA. Hope that helps! the answer to study island....TAACGGGTAC


What sequence is the sequence of the complementary strand of DNA?

its tcaa


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is complementary sequence?

When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.


What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?

The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.


List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?

The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".


If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc


What sequence is complementary to aggtac?

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.


What is the complementary DNA base sequence for the following bases AACT?

The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.


What is the enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence?

DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.


What is the complementary base sequence of DNA strand?

TGCA


What is the complementary DNA for TAC GG?

The complementary strand of this DNA sequence is... A T G C T A A C C