The complementary messenger RNA (mRNA) sequence for the DNA sequence CAAGGT is GUUCCA. In transcription, adenine (A) pairs with uracil (U) in RNA, thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, the DNA sequence CAAGGT is transcribed to mRNA as GUUCCA.
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".
The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.
DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.
When DNA pairing occurs, The following nucleotides will always pair with each other in the following way A-T, C-G (Held together by generally weak Hydrogen bonds). When DNA is transcribed with RNA base pairs, the thymine (T) nucleotide becomes Uracil (U)., thus the complimentary strand for CAAGGT wil be GUUCCA. Hope that helps! the answer to study island....TAACGGGTAC
its tcaa
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".
auc
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.
DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.
TGCA
The complementary strand of this DNA sequence is... A T G C T A A C C