0
What is the complementary strand for this sequence for c-g-t-g-a-g-a-c-c-t-g-g-c-a-c-t-a-a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-G
DNA base-pairing rules
Adenine - Thymine
Cytosine - Guanine
RNA base-pairing rules
Adenine - Uracil
Cytosine - Guanine
What else can I help you with?
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the sequence of complementary strand?
TGCA
What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What is the complementary base sequence of DNA strand?
TGCA
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.
What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?
To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.
What would be the complementary strand of DNA for the following sequence AATGCTGATTCCCGGATCG?
The complementary strand of DNA for the sequence AATGCTGATTCCCGGATCG would be TTACGACTAAGGGCCTAGC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base to form the new strand.
