G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-G
DNA base-pairing rules
Adenine - Thymine
Cytosine - Guanine
RNA base-pairing rules
Adenine - Uracil
Cytosine - Guanine
its tcaa
TGCA
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
auc
TGCA
If you know the sequence of one strand of a DNA molecule, you can predict the base sequence of the complementary strand based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the known strand has the sequence 5'-ATCG-3', the complementary strand would have the sequence 3'-TAGC-5'. This complementary relationship allows for the accurate prediction of one strand's sequence from the other.
TGCA
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.
To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.