0
What would the complementary strand of DNA be for the sequence cttaggcttacca?
Wiki User
∙ 10y ago
GGATCGA is comlementary to the DNA strand CCTAGCT.
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What would the complementary strand of DNA be for the sequence of the base Cttaggcttacca?
lol i hate this question........its in meh science book
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
