0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
DNA replication that unzip the DNA strand is?
What unzips DNA strand is a particular protein called Helicase. Helicase unwinds DNA's double helix at the replication fork.
A strand of DNA formed by the splicing of DNA from two different species called?
recombinant DNA
If a change is made in the DNA strand it is called a?
A mutation
What is the long strand found in the nucleus when the cell reproduces?
DNA (a.k.a. Deoxyribonucleic acid) The strand itself is called chromatin. It is made up of DNA.
What are the two single strands of DNA?
The strand used as a template for mRNA during transcription is called the antisense strand. The DNA strand not used as a template is called the sense strand.Read more: What_are_the_two_DNA_strands
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
Name of the DNA strand which is copied to make mRNA?
This is typically called the template DNA, which is the anti-sense strand of DNA. The strand that is not transcribed is called the sense strand.
What is a single strand of DNA used for DNA testing called?
A single strand of DNA used for DNA testing is called PCR
Transcription makes a complementary strand of the DNA?
This Process Is Called DNA Transcription. *Apex*
IMPORTANT After DNA replication does half of the old strand leave with half of the new strand?
The process of DNA replication is described as being semi-conservative. The complementary DNA strands are pulled apart, new matching nucleotides are connected to each separate strand, and the result is two new strands that each contain exactly one-half of the original DNA strand.
What is the new strand called in Dna replication?
semiconservative replication - original DNA double strand will unwind into 2 strands, so one original strand will serve as a template for synthesizing a new complementary strand , thus forming a new DNA (one with old strand and one with a new strand)
The strand of DNA that is not transcribed is called the strand.?
RNA polymerase runs in one direction and is making up a single strand of mRNA. So, the strand not copied in the antiparallel double stranded DNA is called the nonsense strand. ( sense strand is copied )
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
What is it called a strand of DNA in a neucleus?
chromatin?
DNA replication that unzip the DNA strand is?
What unzips DNA strand is a particular protein called Helicase. Helicase unwinds DNA's double helix at the replication fork.
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
What is RTase?
An enzyme called reverse transcriptase, which creates a DNA strand from an mRNA strand.
