0
What else can I help you with?
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.
What strand of DNA does RNA polymerase use during transcription?
During transcription, RNA polymerase uses the template strand of DNA to create a complementary RNA strand.
3 What is the name of the process in which DNA is copied into a form of RNA?
The process is called transcription. During transcription, the enzyme RNA polymerase converts DNA into messenger RNA (mRNA) by reading the DNA template and synthesizing a complementary RNA strand.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
How does DNA template dictate the sequence of the RNA produced?
During transcription the DNA double helix is separated into two individual strands. Each strand may serve as a template for RNA polymerase, which travels along the DNA structure in a 3' to 5' direction. As it progresses down the strand, RNA polymerase synthesizes a pre-messenger RNA strand that is complementary to the sequence on the DNA template. For example if the DNA sequence on the template was 5' ATACA 3', then the pre mRNA sequence synthesized would be 3' UAUGU 5'. (Remember, RNA synthesis utilizes the nucleotide uracil instead of thyamine).
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.
What is a molecule of Rna complementary to the coding strand DNA in the gene?
A molecule of RNA complementary to the coding strand DNA in a gene is called messenger RNA (mRNA). mRNA is transcribed from the DNA template strand and carries the genetic information from the DNA to the ribosome for protein synthesis. It is made up of nucleotides that are complementary to those on the coding strand of DNA.
The manufacture of a strand of RNA complementary to a strand of DNA is termed?
Transcription
What RNA strand is produced from DNA?
messenger RNA (mRNA)
What strand of DNA does RNA polymerase use during transcription?
During transcription, RNA polymerase uses the template strand of DNA to create a complementary RNA strand.
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
3 What is the name of the process in which DNA is copied into a form of RNA?
The process is called transcription. During transcription, the enzyme RNA polymerase converts DNA into messenger RNA (mRNA) by reading the DNA template and synthesizing a complementary RNA strand.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
When transcription begins the enzyme is called?
the RNA polymerase attaches to the promoter and transcribes the gene in messenger RNA, or mRNA
What monomer is linked in transcription?
In transcription, the monomer linked together is ribonucleotides. These ribonucleotides are added in a complementary manner to the template strand of DNA by RNA polymerase enzyme, resulting in the formation of messenger RNA (mRNA) molecules.
What is an antigenome?
An antigenome is a complementary strand of RNA from which the genome of a virus is constructed.
What connects Rna nucleotides to dNA during transcription?
During transcription, RNA polymerase catalyzes the synthesis of an RNA molecule by base-pairing complementary RNA nucleotides with the DNA template strand. This complementary base pairing allows the RNA nucleotides to be connected to the DNA template, forming a growing strand of RNA that is identical in sequence to the non-template DNA strand.
