0
What would be the base sequence of the complementary mRNA strand?
Wiki User
∙ 12y ago
TGCA
Josianne Prohaska
Wiki User
∙ 12y agoIn DNA; A binds to T, C to G.
When DNA is transcribed on to RNA, the RNA sequence is complementary to the DNA sequence (except U replaces T).
For example; if the DNA sequence was AATGCCTA, the complementary mRNA sequence would be UUACGGAU.
Wiki User
∙ 12y agoIn DNA, A (adenine) binds to T (thymine), C (cysteine) binds to G (guanine).
For a complementary RNA strand, A binds to U (uracil).
For example, the complementary DNA strand for AAT-GCG-TAG would be TTA-CGC-ATC. The complementary RNA strand would be UUA-CGC-AUC.
Wiki User
∙ 12y agoIt is complementary to the sequence of bases on the coding strand.
Wiki User
∙ 12y agoits tcaa
Add your answer:
Earn +20 pts
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
What is the complementary base sequence of DNA strand?
TGCA
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What would the complementary strand of DNA be for the sequence of the base Cttaggcttacca?
lol i hate this question........its in meh science book
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?
tcaa --remember a attracts t while c attracts g
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
