0
What would be the equivalent code for the complimentary RNA sequence For the DNA sequence AATGTCATTGC?
Wiki User
∙ 6y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
GGCAGTTCATGC What would be the sequence of bases on the complimentary stand?
Ccg tca agt acg
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What is the correct sequece for t c a g g a c c g?
The correct complimentary DNA sequence would be AGTCCTGGC. The correct complimentary mRNA sequence would be AGUCCUGGC.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
GGCAGTTCATGC What would be the sequence of bases on the complimentary stand?
Ccg tca agt acg
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complimentary strand of DNA would have the sequence: tacggctagttgg
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
