0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
The base sequence of RNA is what to the DNA from which it is transcribed?
complimentary For example, if the DNA codon is GCA, the complimentary mRNA codon will be CGU, according to the base pairing rule.
What is the sequence of bases of the mrna for tacaaatttgcaaccact?
TAC AAA TTT GCA ACC ACT (DNA) AUG UUU AAA CGU UGG UGA (mRNA)
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
What is the mutation cause of insertion?
An insertion mutation is when an extra nucleotide is inserted into the DNA molecule.For example if the original sequence is:AATGCATGGACTan insertion could be:AATCGCATGGACTThis would change the code from: AAT GCA TGG ACTto AAT CGC ATG GAC T.....You can see that after the insertion all the codes are changed. Since each set of three nucleotides codes for an amino acid, this would change all of the subsequent amino acids in the protein coded for by the gene.
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
What is the anticodon of 5'-CUA-3'?
The anticodon of GCA ia CGU. The anticodon is the sequence of nucleotides on transfer RNA that matches with and transiently binds to the codons on the mRNA during protein synthesis.
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
What complementary strands of DNA would be produced from the strand of DNA?
Gca-tat gca ta The answer is AGC CT cat gt
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
The base sequence of RNA is what to the DNA from which it is transcribed?
complimentary For example, if the DNA codon is GCA, the complimentary mRNA codon will be CGU, according to the base pairing rule.
If the dNA sequence Tgagccatga is change to tgagcacatga what kind of mutation has occurred?
The sequence TGA-GCC-ATG-A is changed in 2 places to become TGA-GCA-CAT-GA.When one base is changed, it is called a point mutation.In this case, a GCC in the DNA has been changed to a GCA. This would mean the mRNA codon (coded for by this DNA) would change from CGG to CGU.Both of these codons code for the same amino acid - Arginine. Therefore this type of point mutation is known as a silent mutation.The extra C that appears would be called an addition mutation, which is a type of frameshift mutation.
Which export is gca EXPORT?
export obligation to export to GCA countries
How would the dna sequence gctata be transcribed to mrna?
The RNA sequence which would be transcribed from the DNA TAG-GCA-TCG would be: AUC-CGU-AGC This is because with DNA and RNA - Adenine (A) binds to Uracil (U), Thymine (T) binds to A, and Cytosine (C) & Guanine (G) bind to each other.
What does 'GCA exports' mean in regards to a 'Quarterly Performance Report'?
GCA Exports
What is GCA countries?
GCA stands for General Currency Area. The list of GCA countries is all countries, excluding some rupee currency countries.
What does the g and a represent in the DNA sequence GAA ttc gca?
G stands for Guanine, which always pairs with Cytosine. A stands for Adenine, which always pairs with Thymine.
