0
What would be the stand of complementary DNA produced by the stand of DNA ATG CGA?
Wiki User
∙ 8y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What would be the mRNA strand for atg cat tag ttg?
caacuaaugcat
What are the three types of mutation?
The three types of Mutations are: Substitution Deletion Addition For example: Mutation stand to compare back to: ATG CAT AGG Mutation#1: ATT CAT AGG It is Substitution in this strand because the "G" was changed to a "T." Mutation#2: ATG ATA GG It is Deletion in this strand because the "A" was deleted. Mutation#3: ATG CAT TAGG It is Addition in this strand because another "G" was added to the end of the strand.
What is the complementary stand to this dna molecule g a t c c a t g a g t t a c?
Gatccatgagttac ctaggtactcaatg
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
When was ATG Stores created?
ATG Stores was created in 1999.
What would be the mRNA strand for atg cat tag ttg?
caacuaaugcat
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What are the three types of mutation?
The three types of Mutations are: Substitution Deletion Addition For example: Mutation stand to compare back to: ATG CAT AGG Mutation#1: ATT CAT AGG It is Substitution in this strand because the "G" was changed to a "T." Mutation#2: ATG ATA GG It is Deletion in this strand because the "A" was deleted. Mutation#3: ATG CAT TAGG It is Addition in this strand because another "G" was added to the end of the strand.
What is the corresponding mrna section of 3'-tgt-ggg-gtt-att-5'?
The mRNA sequence which is complementary to the DNA sequence 5' - GAC ATG GAA - 3' is:3' - CUG UAC CUU - 5'
Are the two strands of DNA identical or complementary?
I don't know what you mean by complementary, so I'll use an example. If a section of one strand of DNA is ATC GGA TAC ACC, then the other will be (in the same direction) TAG CCT ATG TGG If you are looking for the messenger RNA code, change all the Ts to Us in the second code of my answer. Hope this helps!
