0
What would be the effect if one of the bases were deleted in the very first m RNA CODON?
Wiki User
∙ 9y ago
Removing a single base in a genes DNA sequence will cause a frame shift mutation, changing a single base will cause a point mutation. In real terms frame shift mutations cause the most change as all the triplets after the deletion will (probably) now code for different amino acids, this will change the conformation of the final protein. A point mutation may not cause any change at all as there is some redundancy in the triplet code, several codons code for the same amino acid. There is a large amount of redundancy at the third position in a triplet sometimes referred to as third base wobble. If the point mutation is not silent and does change the amino acid there maybe little change to the protein conformation/functionality or there maybe lots of change it depends on the function of the amino acid at that location and how similar the base it has been swapped for is. With so little DNA the peptide would be only 10 amino acids long, so perhaps the sequence is not a gene?
Wiki User
∙ 9y ago
Wiki User
∙ 15y agoIt really depends on what the base is. Some deletion mutations could cause problems like lactose intolerance while others could be fatal if it was at a fetal stage.
Wiki User
∙ 12y agoOk, well we have like a .3% difference in DNA than apes. SO if that is changes, than we are different animals
Wiki User
∙ 12y agoGene is Changed.
Trait Controlled by by the original DNA maybe changed.
Wiki User
∙ 13y agoDNA repair mechanisms would fill in the blank using the sister strand as a template. Usually involves excision of blank area, extend area, ligate.
Wiki User
∙ 9y agoThis is a frame shift mutation , resultant protein would be totally different from normal one .
Add your answer:
Earn +20 pts
What is the first codon of the mRNA ccuagaauuggcc?
The first codon of the mRNA ccuagaauuggcc is "ccu".
First codon to form an amino acid?
AUG. Methionine is the first and start codon in forming polypeptides.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
The first codon on an mRNA always is?
aug
What is the maximum number of amino acids that could be coded for by a sextion of mrna with the sequence guucagaacugu?
A codon is three bases long - so this section of mRNA would have 4 codons; UGA-UUC-AGU-AAC.Each codon relates to a specific amino acid (but several codons can code for the same amino acid, for example both UUU and UUC code for the amino acid Phenylalanine).Normally if you have four codons, such as this section of mRNA, the maximum number of amino acids you could have would be four. However, the first codon in this section, UGA, is actually a STOP codon. This means that when the ribosome reaches this codon, no further amino acids will be joined.This means that no amino acids could be coded for with this section of mRNA. (If the order of the codons was reversed, making the STOP codon last, then the answer would be three).
If an mRNA is made up of 60 bases how many codons does it contain and how many amino acid does it code for?
A codon is exactly three bases long, so an mRNA strand with 60 bases would contain 20 codons. The first codon will encode for methionine (this is called the "start" codon) and the last codon will be a "stop" codon, which does not encode for an amino acid. Thus, an mRNA strand of 60 bases will code for 19 amino acids. Keep in mind, it is possible for a stop codon to be anywhere on the mRNA strand, and when a stop codon reaches the ribosome, translation must stop. For example, if an mRNA strand contained 30 codons, and the 15th were a stop codon, the mRNA would only code for 14 amino acids and then be done. The other 15 codons would go untranslated.
What is the first codon of the mRNA ccuagaauuggcc?
The first codon of the mRNA ccuagaauuggcc is "ccu".
First codon to form an amino acid?
AUG. Methionine is the first and start codon in forming polypeptides.
What happens at a start codon?
A start codon signals the start of translation
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
How might one missing nucleotide or the insertion of one additional nucleotide in a DNA strand alter the formation of the translated protein?
Deletion of just one nucleotide in a protein-coding part of a gene will cause a "frameshift mutation." Since the nucleotides are read in groups of three (codons) along the gene, the groupings will change and the protein that results is likely to be completely different.
The first codon on an mRNA always is?
aug
The first codon to be deciphered was?
UUU and it encodes phenylalanine
What is the genetic code CCATGAT?
It isn't anything (well, obviously it's cytoseine-cytoseine-adenine-thymine-guanine-adenine-thymine, but other than that...). Sequences that code for significant proteins are typically hundreds or even thousands of bases long, since three bases are required to make up a codon. You've given seven, which isn't evenly divisible by three; also, that sequence is DNA, while technically the codons are RNA. Substituting U for T, that particular sequence could be:proline followed by a stop codon followed by a single basea single base followed by histidine followed by aspartic acidtwo bases (the last two bases of a codon for serine, proline, threonine or alanine... you'd have to know the first base to know which) followed by methionine (or possibly a start codon) followed by two more bases (the first two bases coding for methonine if the next base is G or isoleucine if it's anything else).Transcribing to RNA from that DNA sequence would yield AUCAUGG, which could be:isoleucine-methonine (or junk dna-start codon) followed by a single basesingle base followed by serine-tryptophantwo bases (could be tyrosine, histidine, asparagine or aspartic acid) followed by histidine followed by two bases (glycine... no matter what the third base is, GG-anything codes for glycine)
What is the first amino acids?
Methionine, made from the codon AUG.
What is the maximum number of amino acids that could be coded for by a sextion of mrna with the sequence guucagaacugu?
A codon is three bases long - so this section of mRNA would have 4 codons; UGA-UUC-AGU-AAC.Each codon relates to a specific amino acid (but several codons can code for the same amino acid, for example both UUU and UUC code for the amino acid Phenylalanine).Normally if you have four codons, such as this section of mRNA, the maximum number of amino acids you could have would be four. However, the first codon in this section, UGA, is actually a STOP codon. This means that when the ribosome reaches this codon, no further amino acids will be joined.This means that no amino acids could be coded for with this section of mRNA. (If the order of the codons was reversed, making the STOP codon last, then the answer would be three).
Which codon engages a ribosome to start translating mrna molecule?
because of the big penises all around it cumming on it. That's Why.
