0
The Comprehensive Test Banned Trity
Wiki User
∙ 11y ago
Add your answer:
Earn +20 pts
May destroy infected cells select one a cytotoxic t cells b helper t cells c b cells d allergens e phagocytic cells?
T-cells will do this
Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?
In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
Two plants with the genotypes TT and Tt?
B. would have different phenotypes, 1.b 2.c 3.d 4.b 5.c 6.c 7.c 8.c and this
What is ELCB full form?
E a r t h l e a k a g e c i r c u i t b r e a k e r ( e l c b )
What is the full form of ATB?
A = Anti T = Terrorist B = Bureo
N c e r t full form?
The full form for NCERT is National Council of Educational Research and Training. This is a schooling.
Transpose a-t divided by b-t equals c so that t is the subject?
(a - t)/(b - t) = c => a - t = c(b - t) = cb - ct = bc - tc => tc - t = bc - a => t(c - 1) = bc - a => t = (bc - a)/(c - 1)
Can you find a nine letter word with b c t r o a i a c?
These can be rearranged to form "acrobatic".
What is the full form of p t c l?
Pakistan telecommunication company limited
What are 5 forms of equations of lines?
Standard form: ax + by + c = 0 (a, b, c constants, x and y variables)Slope intercept form: y = mx + c (m, c constants, x and y variables)Two points form: given P = (a, b) and Q = (c, d)(y - b)*(x - a) = (d - b)*(c - a ) (a, b, c, d constants, x and y variables)Parametric equation x = a + r*cos(t), y = b + r*sin(t) (a, b, t constants, x and y variables)X = A + k*B (X, A and B vectors, k scalar, X and k variables).The standard form, parametric equation and vector form have simple analogies for 3 or more dimensions.
Write a Program in lisp to find maximum of three numbers?
(defun max3 (a b c) (cond ((> a b) (cond ((> a c) a) (t c))) ((> b c) b) (t c) ) )
What is the full form of b t road?
B.T. Road, Kolkata - Barrackpore (or Barrackpur) Trunk Road
What does 2 c b t a c mean?
2 x b x t x a x c to the power 2
What is the full form of doctor?
a: a d: daddy o: of c: child t: trying to o: oranize r: routine and meals
What is the full form of ITU-T?
Full form of ITU-T is International Telecommunication Union-Telecommunication .
