0
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
Add your answer:
Earn +20 pts
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Complementary dna sequence?
The complementary DNA sequence is a nucleic acid sequence that is the reverse complement of a given DNA sequence. In this sequence, each nucleotide is paired with its complementary base: adenine with thymine and cytosine with guanine. This is important in DNA replication and transcription processes.
What is the complementary messager-rna sequence for DNA sequence shown here caaggt?
When DNA pairing occurs, The following nucleotides will always pair with each other in the following way A-T, C-G (Held together by generally weak Hydrogen bonds). When DNA is transcribed with RNA base pairs, the thymine (T) nucleotide becomes Uracil (U)., thus the complimentary strand for CAAGGT wil be GUUCCA. Hope that helps! the answer to study island....TAACGGGTAC
Which do you suppose would be more harmful A mutation that changed the nucleotide sequence of an mRNA molecule or a mutation that changed the nucleotide sequence of a DNA molecule?
A mutation that changes the nucleotide sequence of a DNA molecule would likely be more harmful as it could potentially affect all mRNA molecules and proteins produced by that DNA. On the other hand, a mutation in an mRNA molecule would only affect the protein coded for by that specific mRNA.
Which of the following statements does not accurately describe DNA?
A change in the nucleotide sequence of a gene
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
What amino acid sequence does the following DNA nucleotide sequence specify tacagaacggta?
this dick
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What does the number 3 represent in the following sequence 11111111111111111111113111?
An interruption.
What is the complementary nucleotide sequence of ccgagattg?
The complementary nucleotide sequence of ccgagattg is ggctctaac.
What does the genetic code specify the correlation between?
The genetic code refers to the nucleotide triplets of DNA and RNA molecules that carry genetic information. It specifies the correlation between an RNA-nucleotide sequence, as well as an amino-acid sequence.
Complementary dna sequence?
The complementary DNA sequence is a nucleic acid sequence that is the reverse complement of a given DNA sequence. In this sequence, each nucleotide is paired with its complementary base: adenine with thymine and cytosine with guanine. This is important in DNA replication and transcription processes.
What does the nucleotide sequence cucaagugcuuc represent?
The nucleotide sequence cucaagugcuuc represents a specific mRNA sequence that codes for specific amino acids during protein synthesis. Each set of three nucleotides, called a codon, corresponds to a particular amino acid or a stop signal in the genetic code.
If the sticky end of a nucleotide sequence is TTAA what is next?
The complementary sequence for TTAA is AATT. This means the next nucleotide in this sequence would be A.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
The DNA sequence for the corresponding strand would be TCCGGTAATCGGGATAAGCCCATATTTACC. This is the complementary sequence, where each nucleotide is paired with its complementary base (A with T and C with G).
