0
What else can I help you with?
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Does mRNA contain uracil or thymine in its nucleotide sequence?
mRNA contains uracil in its nucleotide sequence, not thymine.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
Does RNA contain uracil in its nucleotide sequence?
Yes, RNA contains uracil in its nucleotide sequence instead of thymine, which is found in DNA.
Which of the following statements does not accurately describe DNA?
A change in the nucleotide sequence of a gene
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
What amino acid sequence does the following DNA nucleotide sequence specify tacagaacggta?
this dick
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What does the number 3 represent in the following sequence 11111111111111111111113111?
An interruption.
What is the complementary nucleotide sequence of ccgagattg?
The complementary nucleotide sequence of ccgagattg is ggctctaac.
Does mRNA contain uracil or thymine in its nucleotide sequence?
mRNA contains uracil in its nucleotide sequence, not thymine.
What does the genetic code specify the correlation between?
The genetic code refers to the nucleotide triplets of DNA and RNA molecules that carry genetic information. It specifies the correlation between an RNA-nucleotide sequence, as well as an amino-acid sequence.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What does the nucleotide sequence cucaagugcuuc represent?
The nucleotide sequence cucaagugcuuc represents a specific mRNA sequence that codes for specific amino acids during protein synthesis. Each set of three nucleotides, called a codon, corresponds to a particular amino acid or a stop signal in the genetic code.
If the sticky end of a nucleotide sequence is TTAA what is next?
If the sticky end of a sequence is TTAA, it can bind to a DNA molecule with the sequence AATT
