answersLogoWhite

0

The process is called DNA Transciption. It is when the DNA is copied into mRNA using base pairing - Adenine to Thymine, Guanine to Cytosine. Only the problem here is that when using mRNA, Thymine is replaced with a different nucleotide represented by a U. This is what we need the answer for.

Its Uracil...

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

What nitrogenous base does adenine pair with in an RNA strand?

In an RNA strand, adenine (A) pairs with uracil (U).


What does the G stand for in RNA strand?

It stands for one of 4 bases in RNA, guanine.


What modifications are necessary to rewrite the following DNA strand GGCATTGCA as a RNA strand?

I always place the "strand" vertically. G G C A T T G C A Then i think.. what bonds with what? G with C A with T and when RNA A with U. So in order for the DNA strand and the RNA strand to bond.. they have to have the appropriate reflections. G - C G - C C - G A - U T - A T - A G - C C - G A - U Therefore you're modifications have been made and your RNA strand is this: CCGUAACGU Hope this helps :)


Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?

This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'


What rna strand is complementary to the DNA strand gtagtca?

As long as the DNA strand sequence "CTAGGTTAC" is in the 5' to 3' position, the correct RNA sequence would be "CUAGGUUAC". RNA is identical to the coding strand, which is always read 5' to 3'. The only difference is U replaces T.


How does the nucleated sequence of the coding strand of a DNA molecule differ from the RNA produced?

The nucleated sequence of the coding strand of a DNA molecule differs from the RNA produced in that the RNA contains uracil (U) instead of thymine (T). Additionally, during transcription, the RNA is synthesized as a complementary strand, meaning that adenine (A) in the DNA pairs with uracil (U) in the RNA, while cytosine (C) pairs with guanine (G). Furthermore, the RNA molecule is typically single-stranded, whereas the DNA coding strand is part of a double-stranded structure.


What strand of RNA would be produced from the GCA TTA strand?

The RNA strand produced from the DNA template strand GCA TTA would be complementary and antiparallel. Therefore, the corresponding mRNA sequence would be CUG AAU, as adenine (A) pairs with uracil (U) in RNA, and cytosine (C) pairs with guanine (G).


If the sequence of bases in a nucleic acid were AUCGA is it a strand of DNA?

No, because "U," or Uracil, is found in RNA and not DNA.


Figure 8.2 shows a single strand of DNA. choose the first three nucleotides of the complementary rna strand.?

To determine the first three nucleotides of the complementary RNA strand, you need to match the DNA bases with their RNA counterparts. In DNA, adenine (A) pairs with uracil (U) in RNA, thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). If the first three nucleotides of the DNA strand are, for example, A, T, and C, the complementary RNA strand would have U, A, and G as its first three nucleotides.


What do the template strands of DNA always begin with?

DNA is made of of two complimentary strands, the coding strand and the template strand. When DNA is transcribed (made into messenger RNA which can be converted by ribosomes into proteins) the DNA splits open and free nucleotide bases bind to the template strand. DNA is made of T/C/G/A and RNA is made of U/C/G/A nucleotide bases. G and C bind (they are said to be 'complimentary') A and T bind and in RNA U and A bind (so U replaces T.) The newly formed RNA strand (made on the template stand of DNA) is 'complimentary' to the template but the same as the coding strand of DNA. Hence the template is used to produce RNA which is a copy of the coding strand. Either strand of DNA can act as the template/coding strand. Hope that is a little bit helpful!


Which is the correct transcribed RNA strand for the DNA strand agc caa atg?

The correct transcribed RNA strand for the DNA sequence AGC CAA ATG is UCG GUU UAC. In RNA, adenine (A) is replaced by uracil (U) and thymine (T) by adenine (A).


What molecule builds the new strand of RNA during transcription?

RNA polymerase builds the new strand of RNA during transcription. It catalyzes the formation of phosphodiester bonds between nucleotides to create the complementary RNA strand based on the DNA template strand.