0
What else can I help you with?
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.
How many nitrogen base pairs are present in one strand of human DNA?
There are about 3 billion nitrogen base pairs present in one strand of human DNA.
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
How can one accurately count the number of base pairs in a DNA strand?
To accurately count the number of base pairs in a DNA strand, scientists use a technique called DNA sequencing. This process involves determining the order of the nucleotides in the DNA molecule, which allows for the precise counting of base pairs. Specialized equipment and software are used to analyze the DNA sequence and calculate the total number of base pairs present in the strand.
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.
How many nitrogen base pairs are present in one strand of human DNA?
There are about 3 billion nitrogen base pairs present in one strand of human DNA.
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
If the base sequence on a separated DNA strand is CGTAGG what will the base sequence on its complementary strand be?
The base sequence on the complementary DNA strand will be GCATCC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, for each base in the original sequence CGTAGG, the complementary bases are as follows: C pairs with G, G pairs with C, T pairs with A, A pairs with T, G pairs with C, and G pairs with C again.
What is base sequence of strand II?
To determine the base sequence of strand II, you need to know the complementary base pairing rules of DNA, where adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). If you have the sequence of strand I, you can derive strand II by replacing each base with its complement. For example, if strand I is "ATCG," then strand II would be "TAGC." Please provide the specific sequence of strand I for a precise answer.
What letters would form the other strand of the helix?
In DNA, the other strand of the helix would have complementary base pairs to the original strand. Adenine pairs with thymine, and cytosine pairs with guanine. So, if one strand has the sequence ATTGC, the complementary strand would be TAACG.
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
What complementary strand easier to denature?
The strand with fewer G-C base pairs is easier to denature compared to a strand with more G-C base pairs, because G-C base pairs have three hydrogen bonds, making them more stable and requiring more energy to break apart during denaturation.
The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
How can one accurately count the number of base pairs in a DNA strand?
To accurately count the number of base pairs in a DNA strand, scientists use a technique called DNA sequencing. This process involves determining the order of the nucleotides in the DNA molecule, which allows for the precise counting of base pairs. Specialized equipment and software are used to analyze the DNA sequence and calculate the total number of base pairs present in the strand.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What nitrogenous base does adenine pair with in an RNA strand?
In an RNA strand, adenine (A) pairs with uracil (U).
