answersLogoWhite

0

The strand with fewer G-C base pairs is easier to denature compared to a strand with more G-C base pairs, because G-C base pairs have three hydrogen bonds, making them more stable and requiring more energy to break apart during denaturation.

User Avatar

AnswerBot

1y ago

What else can I help you with?

Continue Learning about Natural Sciences

Given the following strand of dna what is the complementary strand actggctac?

The complementary DNA strand to ACTGGCTAC is TGACCGATG.


What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?

The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.


What do the complementary strand for ccgatacgcggtatcccagggctaattuaa?

The complementary strand for the DNA sequence ccgatacgcggtatcccagggctaattuaa is ggctatgcgccatatgggtaatgtaagg. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each nucleotide in the original strand is matched with its complementary base to form the new strand.

Related Questions

Given the following strand of dna what is the complementary strand actggctac?

The complementary DNA strand to ACTGGCTAC is TGACCGATG.


What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?

The template strand is used to make a complementary copy. This is a type of DNA strand.


What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?

The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.


What is complementary DNA strand for att-cga-tgc?

The complementary strand of the DNA is TAA-GCT-ACG


What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?

The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).


What strand is the messenger rna complementary to?

mRNA is complementary to the template strand of DNA during transcription. The template strand serves as a template for mRNA synthesis, directing the formation of a complementary mRNA transcript.


What would the complementary strand for cttaggcttacca?

The complementary strand for cttaggcttacca would be gaatccgaatggt. This is formed by pairing adenine with thymine and cytosine with guanine on the opposite strand.


What is the complementary DNA?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.


What do the complementary strand for ccgatacgcggtatcccagggctaattuaa?

The complementary strand for the DNA sequence ccgatacgcggtatcccagggctaattuaa is ggctatgcgccatatgggtaatgtaagg. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each nucleotide in the original strand is matched with its complementary base to form the new strand.


What is the base sequene of the complementary strand if the strand of DNA is attccg?

taaggc