answersLogoWhite

0

The pairs are a-t and c-g, so the complementary strand would be: aagcttaacg

User Avatar

Wiki User

12y ago

What else can I help you with?

Continue Learning about Biology

If one strand of DNA has a nucleotide base sequence of tcaggtccat?

If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is the structure of Double stranded DNA molecule in palindromic sequence?

A palindromic DNA sequence is one where the nucleotide sequence reads the same forwards and backwards on both strands. In the double-stranded DNA molecule, the two strands are complementary and run anti-parallel to each other. This means that the palindromic sequence on one strand will have its complementary sequence on the other strand.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.

Related Questions

If one strand of DNA has a nucleotide base sequence of tcaggtccat?

If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is the structure of Double stranded DNA molecule in palindromic sequence?

A palindromic DNA sequence is one where the nucleotide sequence reads the same forwards and backwards on both strands. In the double-stranded DNA molecule, the two strands are complementary and run anti-parallel to each other. This means that the palindromic sequence on one strand will have its complementary sequence on the other strand.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.


What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?

I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.


If a strand of DNA has the sequence aagctc transcription will result in?

If a strand of DNA has the sequence aagctc, transcription will result in a mRNA molecule with the complementary sequence uucgag. Transcription is the process of creating a mRNA molecule using DNA as a template.


How would the bases of the complementary strand read?

The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C


What is the order of bases in the second strand of the DNA molecule?

The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.


What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?

Transcription is the process in which a complementary RNA sequence is synthesized from a DNA template strand. This process occurs in the cell nucleus and is carried out by the enzyme RNA polymerase.


What sequence is the sequence of the complementary strand of DNA?

its tcaa


What determines the nucleotide sequence of the newly synthesised strand during DNA replication?

The nucleotide sequence of the newly synthesized strand during DNA replication is determined by complementary base pairing. Adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The existing DNA strand serves as a template for the formation of the complementary strand.