answersLogoWhite

0

The complementary DNA strand would be TTCGTT.

But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU.

User Avatar

Wiki User

∙ 16y ago

What else can I help you with?

Continue Learning about Chemistry
Related Questions

What would be the strand of complementary DNA produce by the strand of DNA tcg aag?

Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT


What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?

The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?

mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.


What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?

aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua


What strand of mrna would be produced from the strand of DNA shown below gct aag?

GCT AAG would produce the strand of mRNA of "CGA UUC" CGU AAU UGA CUG


If this strand of DNA were used what would be the complementary DNA produced CGA CT?

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).


What is the complementary strand for the sequence c t t a g g c t t a c c a?

G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine


A peptide has the sequence nh2-phe-pro-lys-gly-phe-pro-cooh what sequenes in the coding strand of the DNA codes for this peptide?

The sequence in the coding strand of the DNA that codes for this peptide is 5'-TTC-CCT-AAG-GGC-TTC-CCT-3'. DNA sequences are read in groups of three nucleotides (codons). Each codon corresponds to a specific amino acid in the peptide sequence.


When was Rosedale - TTC - created?

Rosedale - TTC - was created in 1954.


When was Ellesmere - TTC - created?

Ellesmere - TTC - was created in 1985.


When was Kennedy - TTC - created?

Kennedy - TTC - was created in 1980.