0
What else can I help you with?
How do nucleotides translate into amino acids?
Nucleotides in messenger RNA (mRNA) are read in sets of three, known as codons. Each codon corresponds to a specific amino acid. Transfer RNA (tRNA) molecules recognize the codons on the mRNA and bring the corresponding amino acids to the ribosome during protein synthesis. This process is called translation.
What element is important to the hormone that controls metamorphosis in tadpoles?
The element important to the hormone that controls metamorphosis in tadpoles is iodine. Thyroxine, a thyroid hormone that plays a key role in regulating metamorphosis, is synthesized from iodine and tyrosine. Adequate iodine levels are necessary for the proper functioning of the thyroid gland and the production of thyroxine.
Does synthroid contain iodine?
Yes, if Synthroid contains Levothyroxine (3,5,3',5'-Tetraiodo-L-thyronine) then there is 4 Iodine atoms per molecule (..Tetraiodo..) in it![You should ask your chemist for confirmation]Wrong answer: No.Levothyroxine (ingredient in Synthroid, Levoxyl, etc...) is T4 which your body would make on its own from iodine and tyrosine if your thyroid were functioning properly. You would most likely not need to supplement with iodine since your body is not making its own thyroid hormone, but relys on T4 from Synthroid.
Why are mutations such as nitrogen-based additions often much more harmful than nitrogen-based substitutions?
Insertions or deletions causes much severe mutations because they generate frameshift mutations. For example: The sequence AUA-GGA-UAU-CCU is normally translated to I-G-Y-P A substitution such as AUC-GGA-UAU-CCU has no effect on the amino acid sequence because of redundancy in the codon table. (AUC and AUA both code for isoleucine) Another substitution such as AUA-GGA-CAU-CCU is a bit more severe because it changes the sequence to I-G-H-P. However, since only one amino acid is changed, the overall protein may only be slightly affected (however there are instances where a single amino acid change can drastically change the behaviour of the protein, e.g. sickle cell anemia). A deletion such as AU_-GGA-UAU-CCU is much more severe since to the ribosome, the new sequence is AUG-GAU-AUC-CU (a 'frameshift'), and it will be translated as M-D-I, which is completely different from the original sequence and will likely cause the vast majority of the amino acids after the deletion to be incorrect, creating a completely useless protein. An insertion such as AUA-GGA-UAAU-CCU will now be read as AUA-GGA-UAA-UCC-U, which is translated to I-G-Stop-S. This introduction of a premature Stop codon will truncate the protein, once again generating a useless protein.
What does copper wire do?
Some things copper is used for are:Rooftops. It is best against erosion and is cheap, but over the years, it turns a light green due to a long-term chemical change.Copper is also used for copper wiring in houses because it is an amazing conductor of electricity.It is used for wiring alloys brass bronze and silverCopper tubing is used for some plumbing.Copper is used in jewelryIt is used in coinageCoffee pots and cooking pans are often made of copper.copper can be used for batteries, pots, pans, computers, pennies, phones, electricity, and transportation vehicles. It is also used for wiring. Hope that has helped (: xox
Which amino acid is coded by the DNA codon TAC?
It is a triplet of bases (codon) coding for the amino acid tyrosine
What does the amino acid UAC code for?
Phenylalanine.
Tyrosine anticodon is AUA what is DNA base triplet for its codon?
The DNA base triplet that corresponds to the AUA codon in mRNA is TAT.
What amino acid wuld be produced of transcrition takes place from a nucleotide with the three-base sequence ATA?
Tyrosine. If ATA is the DNA codon, the mRNA transcription would be UAU (since A pairs with U in RNA rather than T). UAU codes for tyrosine.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
Which amino acid chain will be formed by the codon AAU?
There would be no change. Both UAC and UAU indicate a tyrosine to be the next amino acid in a polypeptide.Sources:uauuac-biochemistry
What is the amino acid to uua?
what is the true amino acid is that amino acid aau?
What is the sequences of the anticodons for the transfer RNA molecules that carry each of the amino acids in the protein sequence tyrosine leucine proline serine stop codon and threonine?
The anticodon sequences for the tRNA molecules that carry each amino acid are: Tyrosine: 3'-AUG-5' Leucine: 3'-CAA-5' Proline: 3'-GGC-5' Serine: 3'-AGU-5' Threonine: 3'-CGU-5' Stop codon: There is no tRNA anticodon for a stop codon as it signals the end of translation.
Is Tyrosine and L Tyrosine the same thing?
Yes.
How many amino acids are in tyrosine?
Tyrosine is an amino acid.
Is tyrosine a polar or nonpolar molecule?
Tyrosine is a polar molecule.
What would cause tyrosine crystals to be found in urine?
Tyrosine crystals
