They direct a specific Restriction Enzyme to cut the Dna Exactly where required.
gcgtagg
Very Carefully
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
Gct tag tcg
An enzyme unzips a DNA stand and a separate strand without base pairs come sup and matches it with the proper ones (A-U)( C-G) making RNA which goes to a ribosome outside the nucleus, makes a protein, makes a new strand of DNA and the other strand re zips with the new DNA strand.
gcgtagg
1 strand of naked genomic DNA cut by certain enzymes.
DNA molecules. A strand of DNA molecules can be cut to have blunted ends or jagged ends (sticky ends).
The template strand, if reffering to DNA, is the strand of the DNA that is copied to make more DNA.
you have to give the DNA sequence formula for ex: TCGAACT the other half must be AGCTTGA
The term for the 5' DNA strand is the leading strand.
Recombinant DNA.
The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.
The DNA strand that acts as a pattern for the newly synthesized DNA is called the template strand. It serves as a guide during DNA replication, where complementary nucleotides are added to create a new DNA strand.
It is a copy of the Dna original strand.
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The term for the 3' to 5' strand of DNA is the "antisense strand."