0
What else can I help you with?
Which enzyme would cut for this strand of DNA gcatggatcccaatgc?
gcgtagg
How do you calculate the GC content in a DNA strand?
Very Carefully
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
Which dna strand is complementary to cga atc agc?
Gct tag tcg
Explain how DNA replication takes place?
An enzyme unzips a DNA stand and a separate strand without base pairs come sup and matches it with the proper ones (A-U)( C-G) making RNA which goes to a ribosome outside the nucleus, makes a protein, makes a new strand of DNA and the other strand re zips with the new DNA strand.
Which enzyme would cut for this strand of DNA gcatggatcccaatgc?
gcgtagg
How many strands of DNA are there in a DNA fingerprint?
1 strand of naked genomic DNA cut by certain enzymes.
A restriction enzyme is likely to cut which kind of molecules?
DNA molecules. A strand of DNA molecules can be cut to have blunted ends or jagged ends (sticky ends).
What is the strand?
The template strand, if reffering to DNA, is the strand of the DNA that is copied to make more DNA.
What is the half of this DNA strand?
you have to give the DNA sequence formula for ex: TCGAACT the other half must be AGCTTGA
What is the term for the 5' DNA strand?
The term for the 5' DNA strand is the leading strand.
What strand of DNA would be prod from the template strand of DNA shown below?
The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.
DNA from two different organisms that has been cut up and recombined so that the resulting strand contains DNA from both organisms is refereed to as?
Recombinant DNA.
What is the term for the DNA strand that acts as a pattern to the newly synthesized DNA?
The DNA strand that acts as a pattern for the newly synthesized DNA is called the template strand. It serves as a guide during DNA replication, where complementary nucleotides are added to create a new DNA strand.
What is the role of the DNA new strand?
It is a copy of the Dna original strand.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is the term for the 3' to 5' strand of DNA?
The term for the 3' to 5' strand of DNA is the "antisense strand."
