answersLogoWhite

0

First, you must understand that a strand of mRNA, is the complement of one side (the left) of DNA. Basically, you take the one side of the DNA strand and complement it by using these pairs: Adenine:Uracil, Cytosine:Guanine, Thymine:Adenine.

They are all usually abbreviated by their first letter.

Second, in order to find the mRNA, you must understand the process of protein synthesis. If you know the process, then it should be clear that the mRNA is made from one side of the DNA strand during the transcription. It then moves out of the cell and into the cytoplasm to start translation.

User Avatar

Wiki User

15y ago

What else can I help you with?

Continue Learning about Natural Sciences

How is dna made into mRNA?

DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.


What is the base sequence for a DNA strand when given the sequence for a mRNA strand?

To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.


Which strand of DNA transcribes into mRNA?

The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription


Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).


What enzyme is responsible for decodingthe DNA strand into an mRNA?

The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.

Related Questions

How is dna made into mRNA?

DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.


What is the base sequence for a DNA strand when given the sequence for a mRNA strand?

To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.


A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?

The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.


Name of the DNA strand which is copied to make mRNA?

The DNA strand that is copied to make mRNA is the template strand of the gene. This strand serves as a template for the RNA polymerase enzyme to synthesize a complementary mRNA strand during the process of transcription.


Difference between sense and anti sense strands of DNA?

The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.


How many strand of mRNA are transcribed from the two unzipped strands of DNA?

One mRNA strand is made.


Which strand of DNA transcribes into mRNA?

The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription


What is formed when reverse transcriptase is used on strand of mrna?

A strand of DNA


What is formed when reverse transcriptase is used on of strand of mrna?

A strand of DNA


What is the mRNA of the DNA strand aatcgtttaaatatattgggcccgggcccggggcgcg?

UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC


What is formed when reverse transcriptase is used on a strand of mRNA?

A strand of DNA


Which strand of mRNA would be made during transcription using the DNa strand shown below. GCA TAG?

During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).