answersLogoWhite

0

The topoisomerase enzyme uncoils the double helical structure of DNA during its replication to form the replication fork. In eukaryotes both posive and negative supercoils get unbind by topoisomerase I & II respectively.

Topoisomerase isomerase unwinds DNA to form replication fork

User Avatar

Wiki User

10y ago

What else can I help you with?

Related Questions

What is the difference between helicase and topoisomerase?

Helicase is an enzyme that unwinds the DNA double helix during replication, while topoisomerase is an enzyme that helps relieve the twisting forces generated during DNA unwinding by helicase. Helicase moves along the DNA strand, separating the two strands, while topoisomerase cuts and rejoins the DNA strands to prevent overwinding or underwinding.


What is the DNA strand that is synthesized continuously during DNA replication?

The leading strand is the DNA strand that is synthesized continuously during DNA replication. This is because the polymerase enzyme can add nucleotides in the 5' to 3' direction without interruption as the replication fork opens.


What enzyne produces a new DNA strand during DNA replication?

DNA polymerase is the enzyme responsible for producing a new DNA strand during DNA replication. It catalyzes the addition of nucleotides to the growing DNA chain, using the existing DNA strand as a template.


What is the role of topoisomerase II?

Topoisomerase: are isomerase enzymes that act on the topology of DNAHelicase untwists the double helix and separates the template DNA strands at the replication fork. This untwisting causes tighter twisting ahead of the replication fork, and topoisomerase helps relieve this strain


Semiconservative replication involes a template what is the template?

The template for semiconservative replication is the original DNA strand that serves as a guide for creating a new complementary strand. During DNA replication, each original parental strand acts as a template for the synthesis of a new daughter strand.


What are the key differences between topoisomerase 1 and topoisomerase 2 in terms of their functions and mechanisms of action?

Topoisomerase 1 and topoisomerase 2 are enzymes that help manage DNA structure, but they have different functions and mechanisms. Topoisomerase 1 cuts one strand of DNA at a time to relieve tension, while topoisomerase 2 cuts both strands to untangle DNA. Additionally, topoisomerase 1 does not require ATP for its activity, whereas topoisomerase 2 does.


The continually elongating strand of new DNA at one side of a replication fork during replication is known as the?

Leading!


In what direction does a DNA molecule split during replication?

A DNA molecule splits in the 5' to 3' direction during replication. Each strand acts as a template for the synthesis of a new complementary strand.


How many strands are replicated in DNA replication?

During DNA replication, two strands of the double-stranded DNA molecule are unwound and each strand serves as a template for the synthesis of a new complementary strand, resulting in the formation of two new DNA molecules, each composed of one original strand and one newly synthesized strand.


How does DNA polymerase move along the DNA strand, from 3' to 5' direction, during replication?

DNA polymerase moves along the DNA strand in the 3' to 5' direction during replication by adding new nucleotides to the growing strand in a continuous manner. It reads the template strand in the 3' to 5' direction and synthesizes the new strand in the 5' to 3' direction. This process ensures accurate replication of the DNA molecule.


During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


In what direction does DNA polymerase move along the template strand during replication, specifically in the 3' to 5' direction?

During DNA replication, DNA polymerase moves along the template strand in the 3' to 5' direction.