answersLogoWhite

0

In a DNA strand, the "t" stands for thymine, one of the four nucleotide bases that make up DNA. Thymine pairs with adenine (represented by "a") in the double helix structure of DNA. It plays a crucial role in encoding genetic information and is essential for the processes of replication and transcription.

User Avatar

AnswerBot

2mo ago

What else can I help you with?

Related Questions

Transcribe the following strand of DNA into mRNA. DNA T T A G A T?

To transcribe the DNA strand T T A G A T into mRNA, you need to replace thymine (T) with uracil (U) and create the complementary RNA strand. The resulting mRNA sequence would be A A U C U A.


What is the DNA polmerases?

DNA polymerase is an enzyme which synthetizes complementary DNA strand, according to the template strand. So if you have a single-strand DNA, DNA polymerase can sit on it and synthetize the second strand, by the pairing rules - A pairs with T, G pairs with C.


What is complementary strand of c c t a g t c a t g?

In DNA, the complementary strand would be: GGATCAGTAC.


The complimentary strand or matchig strand of DNA for tagtca would be?

It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.


During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?

GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.


A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?

The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.


What strands of DNA is the compliment strand for dna c-c-a-t-c-g?

C binds with G, A binds with T. Therefore the complementary strand of CCATCG IS GGTAGC.


Which DNA strand can base pair with a-t-g-c-t-a?

T-A-C-G-A-T


Which base sequence would be found on the complentary strand of DNA?

If the base sequence on one strand of DNA is A-T-G-C, then the complementary strand would have the sequence T-A-C-G. In DNA, adenine pairs with thymine and guanine pairs with cytosine.


What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?

The complementary bases for the DNA strand aatggccttagcagttgcatga are taccggaaatcgtaacgtaact. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G).


Which of these show is the correct complementary strand of DNA that would be made during DNA replication based on this template strand ATCGGCTACGTACCTA?

Gca ta


What is the complimentary pair of DNA strand a c t g a t g c g a t c t a g c t a t t c c g?

The complementary strand for CGATTAC would be GCTAATG. C and G are always paired together, and A and T are always paired together.