GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.
It would be T-A-A-G-C-C
DNA polymerase is an enzyme which synthetizes complementary DNA strand, according to the template strand. So if you have a single-strand DNA, DNA polymerase can sit on it and synthetize the second strand, by the pairing rules - A pairs with T, G pairs with C.
In DNA, the complementary strand would be: GGATCAGTAC.
GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.
C binds with G, A binds with T. Therefore the complementary strand of CCATCG IS GGTAGC.
T-A-C-G-A-T
If the base sequence on one strand of DNA is A-T-G-C, then the complementary strand would have the sequence T-A-C-G. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
The complementary bases for the DNA strand aatggccttagcagttgcatga are taccggaaatcgtaacgtaact. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G).
Gca ta
The complementary strand for CGATTAC would be GCTAATG. C and G are always paired together, and A and T are always paired together.
The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.