0
What else can I help you with?
What is a complementary DNA strand using a t t g c c a g c?
The complementary DNA strand to "ttgccagc" is "aaggctcg". In complementary base pairing, thymine (T) pairs with adenine (A) and guanine (G) pairs with cytosine (C).
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
What is the complimentary pair of DNA strand a c t g a t g c g a t c t a g c t a t t c c g?
The complementary strand for CGATTAC would be GCTAATG. C and G are always paired together, and A and T are always paired together.
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
If one side of the DNA molecule is t-t-t-g-a-c-c-a-g how do you figure the other side?
To determine the complementary strand of DNA, you would match each base with its complementary base: T -> A, A -> T, G -> C, C -> G. So, the complementary strand to t-t-t-g-a-c-c-a-g would be a-a-a-c-t-g-g-t-c.
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
The complementary bases for the DNA strand aatggccttagcagttgcatga are taccggaaatcgtaacgtaact. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G).
What strands of DNA is the compliment strand for dna c-c-a-t-c-g?
C binds with G, A binds with T. Therefore the complementary strand of CCATCG IS GGTAGC.
What complementary strand of DNA would be produced from the strand DNA shown below?
Assuming it's 5' to 3', The complementary strand would be 3' G-A-A-T-C-C-G-A-A-T-G-G-T 5'
What is the complementary strand for the sequence c t t a g g c t t a c c a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
