answersLogoWhite

0

DNA:
T-C-G-A-T

mRNA:
U-C-G-A-U

mRNA rule: switch T with U
_________________________________________
Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.
A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.

Therefore, if the template DNA strand were T-C-G-A-T, then:

The complementary DNA strand would be A-G-C-T-A
The complementary RNA strand would be A-G-C-U-A

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What would be the base sequence for the complementary DNA formed from CGT TA?

The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What be would the complementary strand of DNA for the following sequence of bases?

lol i hate this question........its in meh science book


What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.


How would the bases of the complementary strand read?

The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C


What sequence is complementary to aggtac?

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


What would be the base sequence of the complementary mRNA strand?

TGCA


Which sequence of DNA bases would pair with the one shown in the partial strand below?

To determine the complementary DNA base sequence for a given strand, you need to know the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the specific sequence of the partial DNA strand, I can help you identify the complementary bases that would pair with it.


List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?

The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".