DNA:
T-C-G-A-T
mRNA:
U-C-G-A-U
mRNA rule: switch T with U
_________________________________________
Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.
A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.
Therefore, if the template DNA strand were T-C-G-A-T, then:
The complementary DNA strand would be A-G-C-T-A
The complementary RNA strand would be A-G-C-U-A
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
TGCA
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.
The complimentary strand of MRNA would be AAUUCCGG.
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
lol i hate this question........its in meh science book
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
ATAGCC is complementary to the base sequence TATCGG.
TGCA
To determine the complementary DNA base sequence for a given strand, you need to know the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the specific sequence of the partial DNA strand, I can help you identify the complementary bases that would pair with it.
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".