0
What else can I help you with?
Complementary strand of DNA for gene segment gccaatgct?
The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.
What does c in CDna stand for?
The "c" in cDNA stands for complementary. cDNA is synthesized from mRNA using reverse transcriptase, resulting in a complementary DNA strand that lacks introns and represents the protein-coding regions of a gene.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.
What is complementary strand of c c t a g t c a t g?
In DNA, the complementary strand would be: GGATCAGTAC.
Complementary strand of DNA for gene segment gccaatgct?
The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.
What does c in CDna stand for?
The "c" in cDNA stands for complementary. cDNA is synthesized from mRNA using reverse transcriptase, resulting in a complementary DNA strand that lacks introns and represents the protein-coding regions of a gene.
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
What is the complementary strand of DNA?
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?
GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.
Is this strand of DNA was used what would be the complementary DNA produced?
To determine the complementary DNA strand produced from a given DNA strand, you pair the nucleotides according to base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. Thus, the complementary DNA sequence is synthesized in the opposite direction.
What strands of DNA is the compliment strand for dna c-c-a-t-c-g?
C binds with G, A binds with T. Therefore the complementary strand of CCATCG IS GGTAGC.
If the strand of DNA were used what would be the complementary DNA produced?
To determine the complementary DNA strand, you would pair each base of the original DNA strand with its corresponding complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand is ATCG, the complementary strand would be TAGC. This base-pairing rule ensures that the two strands of DNA are complementary, allowing for proper replication and function.
What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
What do the complementary strand for ccgatacgcggtatcccagggctaattuaa?
The complementary strand for the DNA sequence ccgatacgcggtatcccagggctaattuaa is ggctatgcgccatatgggtaatgtaagg. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each nucleotide in the original strand is matched with its complementary base to form the new strand.
